1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ilia_Sergeevich [38]
2 years ago
14

Economic importance of grasshopper

Biology
2 answers:
Kruka [31]2 years ago
5 0

Grasshoppers are an important native component of grassland ecosystems in the U.S., playing a role in nutrient cycling and serving as a critical food supply for wildlife.

Basile [38]2 years ago
4 0

Answer:

World-wide, grasshoppers and locusts are among the most economically important pests. Grasshoppers are an important native component of grassland ecosystems in the U.S., playing a role in nutrient cycling and serving as a critical food supply for wildlife.

You might be interested in
What role does mutation play in the evolution of an organism?
Andrew [12]

Answer:

Mutation plays an important role in evolution. The ultimate source of all genetic variation is mutation. Mutation is important as the first step of evolution because it creates a new DNA sequence for a particular gene, creating a new allele.

5 0
3 years ago
I need help ...please seriously
yarga [219]

Answer:

I think the answer is B

Explanation:

5 0
3 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
Which of the following is a function of the nucleus?
ra1l [238]
Builds protein is the correct answer
8 0
3 years ago
Read 2 more answers
Specialized cells within a cat’s eyes allow the cat to...?
kiruha [24]

Answer:

D

Explanation:

5 0
3 years ago
Other questions:
  • What will be the result of photosystem II being exposed to less sunlight?
    9·2 answers
  • Explain why human eggs all contain one X chromosome
    15·1 answer
  • L=long wings and l=short wings. How can two long winged bees produce short winged bees? *
    6·2 answers
  • Mechanoreceptors that react to changes in pressure are part of the _____
    12·2 answers
  • if a mutation appears in one individual that changes one base in a dna sequence to another base in a DNA sequence ot another bas
    7·1 answer
  • In the pentose phosphate shunt, glucose 6-phosphate is oxidized to 6-phosphogluconate, which is then decarboxylated to ribulose
    13·2 answers
  • What is the difference between metaphase in mitosis and metaphase I in meiosis? How are they the same?
    11·1 answer
  • What is the role of each of the following in the carbon cycle? Include an example of each. a) Producer b) Primary consumer c) De
    7·1 answer
  • Why is Cellular Respiration so important?
    7·1 answer
  • During a trip, a lightly-pigmented individual is looking forward to lying on a beach and
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!