Answer:
Location of the Cell Bodies Also, the cell bodies of the preganglionic neuron are located in the brain or spinal cord while the cell bodies of the postganglionic neuron are located in the ganglion. Axons of Preganglionic and Postganglionic Neurons
The Electrons would need to be in a covalent bond. Covalent means that the electrons are equally shared between atoms.
Please mark as brainliest if this helped you:)))
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
Answer:
Some examples of primary succession include the formation of a new ecosystem after a volcano, glacier outbursts, or a nuclear explosion. Some examples of secondary succession include succession after a fire, harvesting, logging, or abandonment of land, or the renewal after a disease outbreak.
Explanation:
<span>Epigenesis is the term which says that an organism develops from the fertilized egg by a succession of developmental events that leads to an adult. This theory was first published by Aristotle. It became a well established and accepted theory in the late 18th century.</span>
