1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Tanya [424]
3 years ago
5

The English moth, Biston betularia, is often cited as an example of observed evolution. There are two colors of this moth, light

and
dark (typica and carbonaria). Kettlewell found that dark moths constituted less than 2% of the population prior to 1848. Then, the
frequency of the dark coloration began to increase. By 1898, the 95% of the moths in Manchester and other highly industrialized
areas were of the dark color. Using the moth example, analyze the events in order to identify support for the statement: natural
selection changes populations, not individuals. Choose ALL that apply.
A)
Variation in the population existed.
B)
Color variation is a result of different gene combinations.
C)
In response to environmental change, moth coloration changed from light
to dark.
D)
Due to natural selection, the ratio of different genetic combinations is
changing
E)
Predator pressure resulted in the light colored genotype being removed
from the gene pool.
Biology
1 answer:
Vlad [161]3 years ago
7 0

Answer:A, B, D, E

Explanation:i just did it on usatestprep, trust

You might be interested in
Which layer of Earth's atmosphere is most strongly affected by conditions on the sun's surface?(1 point)
makvit [3.9K]

Answer:thermosphere

Explanation:

4 0
3 years ago
Agricultural lobbyists have been urging the __________ of farm subsidies.
Bond [772]
<h3><u>Answer;</u></h3>

A. continuation

Agricultural lobbyists have been urging the <u>continuation</u> of farm subsidies.

<h3><u>Explanation</u>;</h3>
  • Farm subsidies also known as the agricultural subsidies, are payments and other kinds of support that is extended to certain farmers and agribusinesses by the U.S. federal government.
  • The original aim of these subsidies was to provide economic stability to farmers during the great depression to ensure a steady domestic food supply to Americans.
3 0
3 years ago
Read 2 more answers
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
3 years ago
Hurricanes get their energy from
son4ous [18]
Wind i mean its a hurricane right and it starts by the wind lol idk
5 0
3 years ago
Which statement best explains the relationship between cellular respiration and photosynthesis? Cellular respiration breaks down
IrinaK [193]
I would go with the first answer.
3 0
3 years ago
Other questions:
  • What is the number of vibrations that occur in a given time interval?
    7·1 answer
  • Celeste is in the end stages of alzheimer's disease. during her final days of life, celeste will
    5·1 answer
  • A tan or a sunburn is the result of exposure to ultraviolet light.<br> O True<br> O False
    6·2 answers
  • What are organism that break down dead organism called
    7·2 answers
  • What is the major form of fuel for certain forms of particle transport by pumps across cell membranes?​
    6·1 answer
  • What is the niche of the clownfish
    14·1 answer
  • Many people believe that vitamins and minerals are essentially the same type of nutrient but they are not: one is an organic mol
    15·1 answer
  • What name is given to the taste receptors and where are they found?
    11·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • Help! How do i do this?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!