1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
yKpoI14uk [10]
3 years ago
11

Which of the following is/are true?

Health
2 answers:
antiseptic1488 [7]3 years ago
6 0
D. all of the above 
hope this helps xx
disa [49]3 years ago
5 0
All of the above, are true
You might be interested in
An enzyme is used to unzip they dna 3'ACTGTACCCATGTGTACTGCCC 5' explication​
s2008m [1.1K]

Answer:

With an eye toward understanding DNA replication, Cornell researchers have learned how a helicase enzyme works to actually unzip the two strands of DNA. The results are published in the journal Nature. At the heart of many metabolic processes, including DNA replication, are enzymes called helicases.

Hope it helps?

Explanation:

5 0
4 years ago
What forms the rings of the ladder of DNA
kow [346]

Answer:

The rings of the ladder are formed by complementary pairs of nitrogen bases — A always paired with T and G always paired with C.

Explanation:

6 0
3 years ago
Read 2 more answers
What vitamin is useful for the growth and development of strong bones and teeth
Lesechka [4]

Vitamin D is used for absoring calcium. Calcium makes bones and teeth strong.

3 0
3 years ago
Read 2 more answers
Cost is a major factor for consumers when purchasing health products <br> True or False?
Lady_Fox [76]



the answer is definately true 
hit that fav button
3 0
3 years ago
Read 2 more answers
Marriage is a long-term commitment.
lubasha [3.4K]
It may help if you and your partner still hold that trust and bond you had created with one another and as married you tend to trust each other more and be more open witch in my opinion a female likes more if the male is honest. If they both respect one another and take care of each others responsibilities then there will be no problems

(Hopefully this helped)
8 0
4 years ago
Read 2 more answers
Other questions:
  • How many calories do you burn while having hiccups?
    5·1 answer
  • Which of the following foods is MOST likely to be contaminated with botulism?
    15·1 answer
  • Which type of muscle fibers is best suited for the lactic acid system?
    12·2 answers
  • A biologist wishes to feed laboratory rabbits a mixture of two types of foods. Type 1 contains 8g of fat, 12g of carbs, and 2g o
    11·1 answer
  • How can i get my legs toned so my upper body can match my lower​
    14·2 answers
  • 10. What are the health-related fitness components?
    7·1 answer
  • What is one of the symptoms of heat stroke?
    10·2 answers
  • 1. Today less than 50% of the NBA players are African American
    9·1 answer
  • Hello feeling bored inbox me​
    10·2 answers
  • Which of the following is most likely to cause Foodborne illness
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!