1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sonja [21]
3 years ago
5

De acuerdo con lo anterior llene el siguiente cuadro comparativo señalando con x si las células procariotas o eucariotas posee l

as estructuras mencionadas
Biology
1 answer:
Maurinko [17]3 years ago
4 0

Answer:

El cuadro no está presente pero las diferencias principales entre células eucariotas y procariotas son:

Eucariotas:

Tienen núcleo

Tienen organelas

Tienen Vacuolas

Tienen Citoesqueleto

Tienen Cloroplastos

El ADN está asociado a proteínas

El ADN es lineal

Presentan mitocondrias

Presentan un sistema de endomembranas

Procariotas:

No tienen núcleo

No tienen vacuolas

No tienen cloroplastos

No tienen organelas

El ADN no está asociado a proteínas

El ADN es circular

Presenta mesosomas

Explanation:

Las células procariotas son más primitivas que las eucariotas, por ende, sus estructuras son más simples. Las células procariotas están en organismos unicelulares tales como las bacterias, mientras que las células eucariotas están en organismos unicelulares y pluricelulares como en plantas, animales, u hongos. La diferencia más notoria entre ambos tipos de células es la ausencia de núcleo en las procariotas haciendo que el ADN está disperso en el citoplasma mientras que en las células eucariotas, el ADN está dentro del núcleo celular.

You might be interested in
Which B.F. Skinner invention allowed him to train subjects through operant conditioning?
Bezzdna [24]

Answer:

A: Cumulative recorder

Explanation:

B. F. Skinner was a psychologist, author, behaviorist and inventor of Operant conditioning chamber and Cumulative recorder.  The purpose of cumulative recorder was to study the rate of operant conditioning. It is a process in which behavior of an organism is modified or an organism is conditioned to perform a specific behavior through giving punishment or reward.

For example: We teach a kid that he should not touch a hot stove because it will burn his hands, or we give him a box of candies to perform a specific task or behave in a certain way. Skinner used Cumulative recorder to find the effect of certain factors on behavior or response of an organism For example: the rate at which lever was pressed by a monkey to get bananas etc.

Hope it helps!

6 0
3 years ago
Read 2 more answers
Hypothesize the importance of language to the early modern humans and how it might have contributed to their success.​
andrezito [222]

Answer:

Human language is unique among all forms of animal communication. It is unlikely that any other species, including our close genetic cousins the Neanderthals, ever had language, and so-called sign ‘language’ in Great Apes is nothing like human language. Language evolution shares many features with biological evolution, and this has made it useful for tracing recent human history and for studying how culture evolves among groups of people with related languages. A case can be made that language has played a more important role in our species’ recent (circa last 200,000 years) evolution than have our genes.

Explanation:

hope it helps

8 0
2 years ago
What is the correct definition of antibodies?
Softa [21]

Answer: The answer is  C

Explanation:

 Antibodies or otherwise called Immunoglobulin are special protein that are produced by certain lymphocytes which produces antibodies which can affect the invading bacteria or other foreign  bodies called the antigens  or other toxins in a number of ways . Certain antibodies known as agglutinins make bacteria harmless by causing them to clump together. The lysins dissolve the outer coats of bacteria, the antitoxin neutralize the toxin of bacteria  while precipitins precipitate the toxin as insoluble and therefore , convert them to a harmless compound. Antibodies are always produced by the immune system.

4 0
3 years ago
Read 2 more answers
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
3 years ago
Read 2 more answers
What is another name for rod shaped bacteria
Kryger [21]

A bacillus or bacilliform bacterium is a rod-shaped bacterium or archaeon.

7 0
3 years ago
Other questions:
  • The statrum ____________ is a single layer of columnar or high cuboidal cells resting on a basement membrane. the stratum ______
    5·1 answer
  • This graph shows how the lynx and snowshoe hare populations can vary over time. How would the lynx population change if a diseas
    12·2 answers
  • What kinds of traits are produced by most mutations?
    8·1 answer
  • What is salinity? what units are used to express the salinity in water?
    14·2 answers
  • During which if the following months is the sun likely to illuminate Earth equally from pole to Pole?
    6·1 answer
  • What does DNA stand for
    9·2 answers
  • Amoeba Sisters Video Recap of Meiosis: The Great Divide<br> answers
    8·1 answer
  • In traditional landscaping, leaves are raked off the ground and bagged. In which of the following ways does this practice most s
    7·1 answer
  • Which prediction is most likely to happen due to solar energetic particles during a solar radiation storm?
    11·2 answers
  • an organism, is found that has the following trraits has a backbone has lungs can reproduce on land what kinfdom does this organ
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!