It is important to make the client understand that while alcohol might not be the cause of their problems or all of their problems it does affect the process of their decision making depending on the situation and how they feel towards different situations. A short-term goal would be to go a week without drinking alcohol and to note their changes in mood, behavior towards others and different challenges that they face. Another option is to set a "challenge" to see how long the client can go without the consumption of alcohol, the longer they go without the bigger the changes they will see in their day to day life.
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
Answer:
a The volume of the liquid should be measured before it is heated.
Explanation:
A student would like to determine how heating a liquid changes its volume. The student hypothesizes that the liquid will increase in volume. The following list shows the steps taken by the student in order to test the hypothesis.
Select the liquid to test.
Place the liquid in a sealed container.
Use a Bunsen burner to heat the liquid by 10°C.
Measure the volume of the liquid.
Record the results.
What is wrong with how the student conducted the investigation?
a The volume of the liquid should be measured before it is heated.
b The hypothesis was not valid because it is impossible for liquids to change in volume.
c The student should have increased the temperature of the liquid by more than 10ºC.
d The length of time it took for the liquid to be heated should be measured.
The answer is A i.e The volume of the liquid should be measured before it is heated. I think this is surely right!!
Answer:
The sample mean is obviously different from the population mean, but tests of significance must be done to determine if the difference is statistically significant. The difference could possibly be attributed to chance or to sampling error.
Explanation:
pls mark me as brainleast and folow me
The answer is C. thousands of galaxies
because<span> Hubble found 10,000 of galaxies just by observing one small little area in space.
So, it has to be thousands.</span>