1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dedylja [7]
3 years ago
8

Which theory states that living things change slowly over time in response to their environment

Biology
1 answer:
GREYUIT [131]3 years ago
8 0
I believe the answer is adaptation
You might be interested in
When a cell copies its DNA (replication), the original DNA ladder is broken apart and new nucleotides are added to the center. T
VladimirAG [237]

1. TTGCATGCTAGCTACGTGTACGTACCGATGCG

2. GGGCCCATACGTACATGCATGCAGCATATAGC

3. GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

You should double check those to make sure I didn't make any mistakes. Hope this helps!

5 0
3 years ago
Which of these correctly explains differences between steroids and enzymes
saveliy_v [14]
Which of what? What’s the rest
8 0
3 years ago
Which factors are responsible for high and low tides?
Vaselesa [24]
The following diagram shows how the moon causes tides on Earth: In this diagram, you can see that the moon's gravitational force pulls on water in the oceans so that there are "bulges" in the ocean on both sides of the planet. The moon pulls water toward it, and this causes the bulge toward the moon.
6 0
3 years ago
bachiko congratulated her staff when the team received an industry award for their project, and also sent a companywide e-mail a
trapecia [35]

Bachiko congratulated her staff when the team received an industry award for their project, and also sent a companywide e-mail announcing it. here, Bachiko is using her <u>personalized</u> power.

In the example above, Bachiko is using his power. Personalized power is the power in which a person has a superiority complex and thinks that he is superior to others. Also, he made sure that people knew that he was someone else's boss.

The sources of management power are as follows:

Positional power

  • strength because of the award/prize.
  • power because you have a certain authority.
  • power because of the punishment given.

Personal power

  • power because you have certain knowledge and abilities.
  • power because of your attractive personality.

Learn more about personal power at brainly.com/question/11656512

#SPJ4

8 0
1 year ago
The flowchart below shows the three generations of a cross between a pea plant that has yellow pods and a pea plant that has gre
tresset_1 [31]

Hello. This question is incomplete. Also, you forgot to show the flowchart. The flowchart is attached below and the full question is:

The flowchart below shows the three generations of a cross between a pea plant that has yellow pods and a pea plant that has green pods. Green pods are the dominant trait. The flowchart is missing the labels that describe the traits.

In which squares should the phrase “Green pods” appear?

1.A and D  2.B and E  3.A,C and D  4.A,B,C,D and E

Answer:

3.A,C and D

Explanation:

As shown in the question above, the flowchart shows the crossing of a pea plant with dominant features (green pods - AA) and a pea plant with recessive features (yellow features - aa). The crossing between plants with AA and aa alleles generates a completely Aa population, which in this case, has the dominant characteristic, that is, it has green pods. This is because the "Aa" alleles are called heterozygous and develop the dominant characteristic.

As we can see in the flowchart, the crossing between the two pea plants generated an offspring that is identified by table C, as we know this offspring has green pods and in the flowchart it is represented by a grayish rectangle. Therefore, we can say that the other gray rectangles represent pea plants with green pods, which are rectangles A, C and D.

4 0
3 years ago
Other questions:
  • A watershed is _____. the valley location where a river ends the mountain area where a river starts an area of saturated soil fr
    9·2 answers
  • What is the limiting factor for the growth of trees in the tundra? question 1 options:
    5·1 answer
  • What component of Earth’s atmosphere exists entirely as a result of photosynthesis?
    12·2 answers
  • Some mutations always occur from generation to generation but most mutations to not persisting overtime in the gene pool which m
    14·1 answer
  • How do cellular respiration and photosynthesis work together to recycle matter
    8·2 answers
  • What is the main advantage to organisms that reproduce sexually is?
    9·1 answer
  • 3 ...The greatest curiosity of the study remains to be mentioned; it was a ponderous folio volume, bound in black leather, with
    7·1 answer
  • planets orbit in perfect circles around stars .... • true •false
    8·2 answers
  • What are some ways to deal with the population of lion fish in the Atlantic Ocean?
    15·1 answer
  • if a yellow (yy) rose and a red (rr) rose cross pollinate with incomplete dominance, what color would their offspring be?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!