Answer:
what is the effect of food availability/competition on natural selection
Explanation:
Something along those lines, this is similar to the Galapagos finches when there used to be just one species but due to natural selection and limited food due to competition, the beaks changed to be able to eat the other food s available that they originally could not eat. There are now about 14 due to this.
I hope this helps u!
Pls give a brainliests(had 40 down to 1 no reason) and a thx ;)
Answer:
First, you must know what the stop codons are: UAA, UAG, and UGA
Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed
Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"
Explanation:
Answer:
I think this is the answer
Explanation:
Chloroplast. Chloroplasts are organelles found in plant cells and eukaryotic algae that conduct photosynthesis.
Answer: Genetic engineering has many applications to medicine that include the manufacturing of drugs, creation of model animals that mimic human conditions and gene therapy.
Explanation:
Answer: In meteorology, an occluded front is a weather front formed during the process of cyclogenesis, when a cold front overtakes a warm front. When this occurs, the warm air is separated (occluded) from the cyclone center at the Earth's surface. i found this on Wikipedia if u want to find more
Explanation:
