1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Korvikt [17]
2 years ago
10

Pls help :(

Mathematics
1 answer:
Masja [62]2 years ago
4 0

Answer:

similarity

Step-by-step explanation:

look , dude

the two triangles have the following features:

the angle B= angle C = 90 degree

the angle A= the angle F

so  the third angle in the first triangle = the third angle in the second triangle

so you have one condition of similarity which is the three angles are equal

to get the answer for lengths :

ab/fe= constant of proportionality

thus ab/fe=2.5/5=.5

so ac/13=.5 thus ac=6.5

and 6/de=.5 so de=12

You might be interested in
Find the slope (-2,3)<br>(-1,0).<br>Hint: use rise/rum to find the slope​
Andru [333]

The slope is negative 3.

5 0
3 years ago
Read 2 more answers
How do I simplify these expressions?<br> 5(x+8)+3<br> 3.6x-7-5.1x<br> 4+8x+2.2-10x
Aleks04 [339]

Answer:

1. 5x +43

2. -1.5x - 7

3. 6.2 - 2x

Step-by-step explanation:

<u />

<u>Equation 1:</u>

5 (x+8) +3

First, we can distribute the 5 to the (x+8) and get 5x + 40. Distributing is when we multiply the 5 by the first number (x) and then by the second number (8) Because they aren't like terms (don't both have x's) we cannot combine then and must keep them separated by a subtraction sign

Now we have: 5x + 40 + 3

Next, we can combine the like terms. This means that any that have the same variable can be combined. So, the 5x has no other x's so he has to stay how he is. The 40 and the 3, however, can be added together to get 43.

Our finished equation is: 5x + 43

<u />

<u>Equation 2:</u>

3.6x - 7 - 5.1x

First, we can combine like terms as we learned in the last problem. This would be our x's since we have multiple.

We can add 3.6x and -5.1x and get -1.5x

Now we have: -1.5x - 7

<u />

<u>Equation 3:</u>

4 + 8x + 2.2 - 10x

We can start with either the numbers with x's or without but I'll just do the x's. So we have 8x and -10x. Adding these together would get us -2x.

Next, we can combine 4 and 2.2 and get 6.2.

Now, putting these back into our equation would look like this:

6.2 - 2x

I'm not sure how much my explanations helped, but I hope you understand!!

8 0
3 years ago
What is the horizontal asymptote for the above function? y=x/x^2-16<br><br>y=​
sergeinik [125]

\bf y = \cfrac{\stackrel{\textit{degree of 1}}{x^1}}{\underset{\textit{degree of 2}}{x^2-16}}   when the degree of the denominator is greater than that of the numerator, the only horizontal asymptote occurs at y = 0.

8 0
3 years ago
3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5'
sdas [7]

3. The original sequence

TAC - CGC - TTA - CGT - CTG - ATC - GCT

codes for

tyr - arg - leu - arg - leu - ile - ala

while the mutated sequence codes for

TAC - CGC - TTA - TTA - TTA - CGT - G<u>CT</u> - <u>G</u>CT - ATC - GCT

tyr - arg - leu - leu - leu - arg - <u>ala</u> - ala - ile - ala

There are several frameshift mutations involved here:

• the first inserts 6 bases (TTA - TTA)

• the second inserts 1 base (G) before the CTG triplet (underlined)

• the third inserts 2 bases (CT) after the CTG triplet

4. The original sequence is the same as before. The mutated sequence

TAC - CGC - TAA - TTA - TTA - CGT - G<u>CT</u> - <u>G</u>CT - ATC - GCT

codes for

tyr - arg - STOP - leu - leu - arg - ala - ala - ile - ala

Then

• there is a (nonsense) point mutation that swaps T for A in the original TTA triplet (nonsense since it produces a stop codon that would halt replication/expression)

• there is a frameshift mutation that inserts 3 bases (TTA)

as well as two other frameshift mutations that also occurred in the previous part.

7 0
2 years ago
A day on saturn is 42.6% of a day on earth. how many hours are there in a day on saturn?
raketka [301]

Answer:

10 full hours (10.224 is exact)

Step-by-step explanation:

4 0
3 years ago
Other questions:
  • How many real solutions does a quadratic equation have if it's discrimination is zero
    13·2 answers
  • Whats the midpoint between 2 and 8​
    8·2 answers
  • PLEASE HURRY LOT OF POINTS AND WILL GOVE BRIANLIEST!
    11·2 answers
  • Hector is flying a kite. He has let out 86 feet
    5·1 answer
  • A painting crew reported that a job is 3/5 completed. What fraction of the job remains to be done?
    6·2 answers
  • Solve this equation 1 = 1 - 2n + 8
    7·1 answer
  • Houses can be either domed or octagonal.<br> True<br> False
    9·2 answers
  • all of the students at mountain range foreign language. 5/8 students take spanish.3/10 of the students take french.the remaining
    15·1 answer
  • Need this asap, thanks in advance :)
    8·1 answer
  • The temperature of a gas decreases 0.045°C every minute for 8 min. What is the change in the temperature of the gas? Use a posit
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!