1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
yuradex [85]
2 years ago
5

Strontium-90 has a half life of 29 years, how much strontium-90 is left from the Chicago pile reactor that was active around 87

years ago.
Biology
1 answer:
agasfer [191]2 years ago
6 0

Answer:

The answer is below

Explanation:

The half life of a substance is the time required by that substance to reduce to half of its initial value. The half life is calculated using the formula:

N(t)=N_o(\frac{1}{2} )^\frac{t}{t_\frac{1}{2} } \\\\where\ N(t)=quantity\ of\ substance \ remaining, N_o=initial\ quantity\\of\ substance, t=time\ and \ t_\frac{1}{2}=half\ life\ of\ substance

Given that t = 87 years, half life = 29 years, therefore the quantity of strontium-90 left is:

N(t)=N_o(\frac{1}{2} )^\frac{87}{29} \\\\N(t)=N_o(\frac{1}{2} )^\frac{t}{t_\frac{1}{2} } \\\\N(t)=N_o(\frac{1}{2} )^3\\\\N(t)=\frac{1}{8} N_o

That is one-eight of Strontium 90 would be left after 87 years

You might be interested in
What is the maximum number of covalent bonds a carbon Atome conform with other Atoms
JulijaS [17]
Carbon atoms got 4 surface electrons which makes them in the middle regarding the electrical surface charge and they can make a maximum relations of 4
3 0
2 years ago
Porque es posible utilizar nuestro cuerpo para que funcione algunos de estos experimentos​
DiKsa [7]

Answer:

Si.

Explicación:

Sí, es posible utilizar nuestro cuerpo para realizar algún trabajo experimental con el fin de obtener más conocimientos sobre el cuerpo humano y sus respuestas. Estos experimentos ayudan a fabricar nuevos medicamentos y nuevos métodos para mejorar la salud del cuerpo. Sin realizar experimentos, no podemos conocer las diversas reacciones que ocurren en su cuerpo y sus beneficios en el cuerpo humano.

8 0
3 years ago
An adult female client describes the pain in her hand as having an audible grinding and cracking sound, especially in her thumb
slamgirl [31]

Answer: The correct answer to the question is option C

OSTEOARTHRITIS.

The client has a degenerative form of disease that is evidenced by osteoarthritis.

Explanation: Osteoporosis is otherwise known as degenerative joint disease.

In a healthy joint,a protective cartilage cushions the end of bones(articulating bones) and as well acting as a shock absorber.

In osteoarthritis,these cartilage that acts as a cushion to the bones wears down down or generates with time exposing the joint and the bones predisposing them to mild to moderate friction that occurs as a result of mobility of the bones/joint.

Osteoarthritis mostly affect joints of the hips, hands,spine and knees.

Some of the common symptoms of Osteoarthritis are;pain in the joints of the hands,knees,hips,lower back and neck with crackles,stiffness and tenderness of the joints which often results to difficulty in walking and deformity of the joint if left untreated.

7 0
3 years ago
What could a human living now and a horse living thousands of years ago have i'm common
nalin [4]
They are made of some of the same matter
3 0
2 years ago
What is one strand of a duplicated chromosome called?
Lady bird [3.3K]

Answer:

It is called a CHROMATID

5 0
3 years ago
Other questions:
  • What protects earths surface
    11·1 answer
  • Which of the following is not a possible cause of erosion? a. burrowing animals b. gravity c. water d. none of the above
    12·2 answers
  • You are a doctor whose patient is missing an enzyme for necessary for successful digestion. You decide to attempt ____, or the m
    7·1 answer
  • Based on the timeline, about how many years ago could the oldest mammalian organism have lived?
    8·2 answers
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Sally's teacher tells her to find the masses of a sugar cube and a glass of water. Sally finds the masses to be 10 g for the sug
    11·2 answers
  • Individual
    10·1 answer
  • hi can u Help me in my hw, Define the following terms:1)Epicenter 2)Seismograph(don't answer if u don't know the answer plz)​
    11·2 answers
  • Why is the greenhouse effect on Earth not as drastic as on Venus? (1 point)
    7·1 answer
  • Ribosomal subunits are large complexes composed of numerous polypeptides and at least one rrna molecule. Which subunits include
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!