1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
AfilCa [17]
3 years ago
11

Me walking into school when i know im dress code

Biology
2 answers:
Anvisha [2.4K]3 years ago
8 0

Answer:

;

Explanation:

Juli2301 [7.4K]3 years ago
3 0

Answer:

d r e s s c o d e

Explanation:

You might be interested in
What 2 reasons color is not a good way to identify minerals
lukranit [14]

Lots of minerals have the same colour as another. Also, one mineral can be different colours as well. I hope this had helped you.

8 0
4 years ago
Read 2 more answers
Which statement describes the difference between photosynthesis in chloroplasts and cellular respiration in the mitochondria?
aev [14]

Answer:

Which statement describes the difference between photosynthesis in chloroplasts and cellular respiration in the mitochondria?

A. Photosynthesis requires reactants and products, but cellular respiration does not.

3 0
3 years ago
PLZ HELP QUICK!!!
Ivenika [448]
I think it’s A. The plasma membrane
3 0
3 years ago
What do you think will happen if all the plants on earth disappeared?
hammer [34]

Answer:

well since animals need to feed off each other and some animals eats plants so if the animal that eats plants will be gone, and then the animals that eat animals will be gone and we wont survive because no trees and no food

Explanation:

4 0
3 years ago
Read 2 more answers
How do i find the genus and species of a living or extinct organism?
enot [183]
The genus and species of a living or an extinct organism is the category that an organism is classified in. This also gives organisms specific names used for binomial nomenclature.
7 0
4 years ago
Other questions:
  • individuals within a population have slightly different traits. How do there differences improve the likelihood that the populat
    9·1 answer
  • Bipolar disorder has a _______________ rate of heritability suggesting a biological cause.
    9·1 answer
  • Which muscles control elimination
    13·1 answer
  • In a pediatric unit, a child's caregiver asks the nurse, "How is hepatitis B immunoglobulin administered to an infant?" Which st
    15·1 answer
  • 3
    15·1 answer
  • In lateral gene transfer, genes are ______.
    8·1 answer
  • Which one of the following criteria is necessary for natural selection to occur? A. Individuals show no variation in fitness lev
    14·2 answers
  • TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA
    12·1 answer
  • For a commercial application using an enzyme, the progress of the
    5·1 answer
  • Which best describes the fossil record?<br> The fossil record cannot provide evidence of evolution
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!