1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Pepsi [2]
3 years ago
7

I need help with this please (click to see picture)

Biology
1 answer:
Blababa [14]3 years ago
4 0
What is the A-D section of the paper, or is that one not important (i will help you in the comments after i know that information)
You might be interested in
NEED HELP ON THIS PLEASEEE
Rufina [12.5K]
The 1st and 4th sentence
7 0
3 years ago
Professor Tan studies water quality in streams near chemical plants. Which is a type of qualitative data that Professor Tan
vitfil [10]
It should be pH (sorry if it’s wrong)
4 0
3 years ago
To which of the following is carbon bonded to create a molecule
Anika [276]

Answer:

D. A nucleus

Carbon contains four electrons in its outer shell. Therefore, it can form four covalent bonds with other atoms or molecules. The simplest organic carbon molecule is methane (CH4), in which four hydrogen atoms bind to a carbon atom

4 0
3 years ago
How does the ingredients in a cell membrane affect its function?
love history [14]
Membrane functions are important for transporting substances across the cell membrane
5 0
3 years ago
A homozygous tomato plant with red fruit and yellow flowers was crossed with a homozygous tomato plant with golden fruit and whi
Alecsey [184]

Answer:

I think it's A correct me if am wrong am not that smart am sorry if am wrong

6 0
3 years ago
Other questions:
  • A average sneeze travels at about 100 miles an hour. Rebecca designs an experiment to increase the speed of sneezes. She subject
    15·2 answers
  • How does the tympanic membrane work?
    13·2 answers
  • What is the purpose of a clincal study report
    7·1 answer
  • What are some examples of specialization?
    10·1 answer
  • The observable, measurable outward characteristics of an organism are called the
    5·1 answer
  • 21.
    11·1 answer
  • What occurs during the transition from stage A to stage B in the picture?
    14·1 answer
  • 3.
    6·2 answers
  • What is the complementary DNA of TACCGGATGCCAGATCAAATC?
    10·1 answer
  • List two diseases that are the result of a viral<br> attack on the human nervous system.
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!