A student is studying the process of weathering and erosion by wind. The student takes down notes shown below:

DNA transcription-to-translation # 1 Homework Unanswered Due in 4 days Given the following sequence of the coding strand, writte

uysha [10]

Explanation:

Translation is the process by which a polypeptide is polymerized from genetic information.

Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).

DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'

mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'

mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.

In order to do this we need to look up the genetic code and assign the proper amino acids.

Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.

3 0

3 years ago

The molar solubility of magnesium carbonate is 1.8 Ã— 10â€“4 mol/l. What is ksp for this compound?

Serhud [2]

Answer:

3.2 × 10⁻⁸

Explanation:

Let's consider the solution of magnesium carbonate.

MgCO₃ ⇄ Mg²⁺(aq) + CO₃²⁻(aq)

We can relate the molar solubility (S) with the solubility product (Ksp) using an ICE chart.

MgCO₃ ⇄ Mg²⁺(aq) + CO₃²⁻(aq)

I 0 0

C +S +S

E S S

The Ksp is:

Ksp = [Mg²⁺] × [CO₃²⁻] = S × S = S² = (1.8 × 10⁻⁴)² = 3.2 × 10⁻⁸

4 0

3 years ago

Read 2 more answers

13. How many moles of zinc are in 25.00 g Zn?

topjm [15]

0.3824 moles of Zinc

4 0

3 years ago

This download is my science worksheet. It's about different types of energy in a situation, like examples. btw this is 7th grade

scoray [572]

All types of energy can be resumed into two basic types of energy which include kinetic energy and potential energy.

<h3>What is kinetic energy?</h3>

Energy is the ability to perform a given work. Kinetic energy is energy in movement, whereas potential energy is stored energy.

For example, plant photosynthesis makes reference to chemical energy (potential energy), popcorn makes reference to thermal energy, etc.

In conclusion, all types of energy can be resumed into two basic types of energy which include kinetic energy and potential energy.

Learn more about kinetic energy here:

brainly.com/question/25959744

#SPJ1

8 0

2 years ago

An electron in a hydrogen atom has orbital quantum number l = 7. how many possible values of the magnetic quantum number ml coul

MA_775_DIABLO [31]

A total of 15 magnetic quantum values are possible.

<h3>What is a Magnetic quantum number?</h3>

One of the four quantum numbers that describe an electron's position in relation to the nucleus is its magnetic quantum number.

Between spin and azimuthal quantum numbers, the magnetic quantum number comes in third on the list. The electron is positioned in one of the various orbitals formed by the division of the subshells (such as s, p, d, and f). It specifies the spatial direction of an orbital of certain energy (n) and form (I). The number of orbitals in each subshell is given as 2+1, where is the azimuthal quantum number. We can determine the orbital in each sub-shell using that method.

We are aware that there are between -l and +l conceivable magnetic quantum numbers.

Here l = 7

Thus, the range of magnetic quantum numbers will be -7 to +7.

Thus, the magnetic quantum numbers are as follows:

-7, -6, -5, -4,-3,-2,-1, 0, 1,2,3,4, 5, 6,7

This opens up a total of 15 magnetic quantum numbers.

To learn more about Magnetic Quantum, visit:

brainly.com/question/24204727

#SPJ4

6 0

2 years ago