1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Black_prince [1.1K]
3 years ago
6

Which takes place inside the chloroplast?

Biology
2 answers:
nydimaria [60]3 years ago
5 0

Answer:

C

Explanation:

The light reaction takes place in the thylakoid discs. Inside, water (H20) is oxidized, and oxygen (O2) is released. The electrons freed up from water are transfered to ATP and NADPH. The dark reaction occurs outside of the thylakoids. In this reaction, the energy from ATP and NADPH are used to fix carbon dioxide (CO2). The products of this reaction are sugar molecules and other organic molecules necessary for cell function and metabolism.

*Note the dark reaction takes place in the stroma (aqueous fluid surrounding the stacks of thylakoids) and the cytoplasm.

allsm [11]3 years ago
4 0

Answer:

dark and light reaction both is the right answerrrerreer

You might be interested in
What happens to the electron from glycosis and kreb cycle?
mixer [17]

Glycolysis occurs in the cytosol, but the Krebs cycle and electron transport chain occur inside the mitochondria. Electron carriers such as NADH produced during glycolysis and the Krebs cycle pass their electrons to the electron transport chain, which results in synthesis of a lot of ATP.

3 0
3 years ago
Read 2 more answers
11. The arrows on the left and right sides of Figure 1 show the effects of one species on the species that are on
daser333 [38]

The image related to that question is attached below.

In the figure, we can see that on the left side, sea otters are very influential in the population of sea creatures, if the killer whales are not in the environment. That's because sea otters are strong predators of sea urchins. However, sea urchins are not as influential in the size of the seaweed population, providing little effect on that population. This is because sea otters control the population of sea urchins through predation. Thus, if more sea urchins are consumed by sea otters, the sea urchin population becomes small and consequently the consumption of algae (by sea urchins) is small.

On the right side of the figure, killer whales are great predators of sea otters and establish a strong predatorism, being very influential in the population of sea otters. This predatorism causes the otter population to decrease and stay in controlled and limited sizes. In this case, with few sea otters in the environment, their predatorism in relation to sea urchins is less, allowing the sea urchin population to grow and to consume more seaweed, providing a strong impact on the seaweed population.

8 0
3 years ago
The amount of dna in a human cell during g2 is most accurately described as?
alexira [117]
Its described as 2n. <span />
8 0
3 years ago
1. If we want to describe work, we must have (2 points)
MatroZZZ [7]

Answer:

Yes cause work is used by energy ⚡ and energy is the ability to do something

6 0
3 years ago
Which of the following is NOT a characteristic of Fontanels?A they are important areas where oxygen can pass through to the deve
kow [346]

Answer:

They are important areas where oxygen can pass through to the developing brain in infancy

Explanation:

Fontanel is a structure that is present in the skull of human infants and it compromises of soft membranous gaps known as sutures.

The function of the fontanels is as follows:

1. To allow stretching of the neurocranium and also allow its deformation during the rapid expansion of the brain.

2. To flex the skull of the infant so that it can easily pass through the birth canal at the time of delivery.

There are 6 fontanels present in the brain -

A. Present at the sides of the head.

B. The anterior fontanel.

C. The posterior fontanel.

D. lateral fontanels.

6 0
3 years ago
Other questions:
  • Aaron crossed two pea plants. One pea plant was homozygous tall (TT) and the other was homozygous short (tt). What are the possi
    8·2 answers
  • Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has
    15·1 answer
  • How do human have a sense of taste, and why do they need it?
    10·2 answers
  • Which of the following statements is correct for the karyotype?
    8·1 answer
  • Active transport is different from passive transport in that active transport involves
    15·1 answer
  • PLEASE HELP ME!!!<br><br>Does each gene influence only one phenotypic trait?
    5·1 answer
  • 0.6Answer the riddle.
    11·1 answer
  • Compare the terms biotic and abiotic factors. Provide examples of both that occur in a shallow ocean
    8·1 answer
  • A. <br> B.<br> C.<br> D. <br> Astronomy.
    11·1 answer
  • Estado mental que puede provocar un ciclo irregular.
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!