1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
zalisa [80]
3 years ago
12

Which of the following is a complex relationship between organisms and their environment?

Biology
1 answer:
vovikov84 [41]3 years ago
6 0
The answer is A,hope this helps !
You might be interested in
LISA is an example of a(n): A) enzyme assay. B) biological assay. C) binding assay. D) immunological assay E) none of the above
Ivanshal [37]
D. Daddy daddy said you were coming to my grandma to get some food now I need a bottle for you tomorrow and I’ll come bye lol I need a little girl e.
7 0
2 years ago
The plant below is purebred for height tall. Write the alleles of this plant. In any cross for height, what kind of Offspring wi
Tomtit [17]

Answer:

TT

All tall

Explanation:

If an organism is purebred, that means it is homozygous. That means, it contains two copies of the same allele (trait) at this particular gene. Lets denote the tall allele as T. That means the plant is TT, and purebred tall.

No matter what genotype (i.e. what 2 alleles) another plant has, the offspring will always be tall. That is because it will always inherit one T from the TT parent. Even if we cross it to a tt plant, all the offspring would be Tt. They would be heterozygous, but they would be tall.

5 0
3 years ago
Please help me with put the examples in the right categories
artcher [175]

Answer:

Ambot nimo hahahhahahahahhahaa

6 0
3 years ago
What could happen to the environment if there were no environmental scientists to monitor it? a. decline in air, land and water
katrin [286]
Id say b
but thats just me
3 0
3 years ago
Read 2 more answers
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
2 years ago
Other questions:
  • Wich statement about cellular respiration is true
    13·1 answer
  • Is a vacuole found in a plant or animal cell​
    6·2 answers
  • 1) The genetic material is duplicated
    13·2 answers
  • The phrase and diagram represent an important law in science. That is
    9·2 answers
  • What is the importance of the light and dark reactions in photosynthesis?
    10·1 answer
  • If the population of sea lions were to undergo an increase in emigration, how would that affect the population of small fish on
    8·1 answer
  • Help me please! Thank you so much!
    10·2 answers
  • Which of the following is not a molluscan class?
    9·1 answer
  • This connective tissue is made of hard calcified matrix and stores calcium and other minerals.
    6·1 answer
  • A large population of moths contains 35% white moths caused by the double recessive genotype, bb. What are all the allelic and g
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!