1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kicyunya [14]
2 years ago
11

Which of the following is true of predator prey population trends?

Biology
1 answer:
evablogger [386]2 years ago
7 0

Answer:

There is no relationship

Explanation:

You might be interested in
Which two oxides are emitted into the air when power plants produce electricity? 
Alinara [238K]

Answer:

sulfur oxide and nitrogen oxide

Explanation:

these are released from power plants along with carbon dioxide

8 0
3 years ago
Which of these chemicals is needed in order for the metabolic reactions of photosynthesis to occur?
adell [148]
Photosynthesis is 
6 CO2 + 6H2O---> C6H12O6 + 6 O2. So unless I understand the question wrong, none is needed to do, but glucose and oxygen are products after the photosynthesis
3 0
3 years ago
Read 2 more answers
During the rock cycle, ______________ follows erosion. *
noname [10]

Answer:

deposition

Explanation:

Hope this helps and have a great day!!!!

5 0
2 years ago
Read 2 more answers
Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi
jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0
3 years ago
The endoplasmic reticulum is a ____.​ a. ​site where the cell synthesizes new protein molecules b. ​structure that separates the
Gemiola [76]
​site where the cell synthesizes new protein molecules

6 0
3 years ago
Other questions:
  • How can biological weathering result in chemical erosion?
    6·1 answer
  • Describe the role / function of mrna, trna and rRna
    7·1 answer
  • Due to human activity, the temperature of the ocean has increased to above normal conditions, causing coral bleaching to occur.
    14·1 answer
  • If someone says, "Earth and all of its contents were created for the betterment of human beings, so as long as something is good
    9·1 answer
  • What glues together molecules in adhesion and cohesion?
    5·1 answer
  • What is an ionic bond?
    7·2 answers
  • True or false all cells living or dead can produce new living cells ​
    7·2 answers
  • How does it make you feel to know you have likely eaten a genetically modified food?​
    13·1 answer
  • Salts and sugars work to preserve food by creating a
    12·1 answer
  • Helppppp will mark brainliest!!!!!
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!