All of them are correct soil erosion turns grains of soil into mere grains of sand which when placed in water makes the water much cloudier, biodiversity will decrease as soil erosion leads to a more Barron and dry landscape, respiratory disease may be caused by inhaled particles of dust which can be create from soil erosion, and desertification as mentioned earlier soil erosion leads to a more baron and dried out landscape as the soil can’t hold water as much as it used too.
The subatomic particles of protons and neutrons are found in the nucleus of an atom. Protons are particles with a positive charge, while neutrons have no charge. Electrons, which have a negative charge, are particles that can found orbiting outside the nucleus of an atom.
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
The statement 'when paired with an immunosuppressant drug, saccharine (sugar) did not have immunosuppressant effects on rats' is FALSE. Saccharine is an artificial sweetener.
<h3>Immunosuppressant drugs and saccharine</h3>
Immunosuppressant drugs are a type of drug that exhibits a depressive effect o the immune system of the individual.
Immunosuppressant drugs include, for example, adalimumab, infliximab, calcineurin inhibitors, cyclosporine, etc.
Moreover, saccharin is an artificial sweetener that is 400 times as sweet as sucrose (sugar).
Learn more about immunosuppressant drugs here:
brainly.com/question/830058
<span>she opens her eyes but does not answer any questions.
This is because she is suffering from dementia. She does not know what to do in your shoes anymore because she lost her humantiy.</span>