Answer:
Viruses can infect only certain species of hosts and only certain cells within that host. The molecular basis for this specificity is that a particular surface molecule
So they are cell specific
Explanation:
Thymine(T) pairs with adenine(A)
Adenine(A) pairs with uracil(U)
Cytosine(C) pairs with guanine(G)
therefore the corresponding mRNA strand for TACGGGATAAGGCCACCTCTGGTAGACCACATT
is
AUGCCCUAUUCCGGUGGAGACCAUCUGGUGUAA
The answer to the question is that it is
I would think plastic wrap but not 100% sure
Answer:
Scientists.
Explanation:
No government can understand the cause of any environmental issue and the way to solve it or reduce the effect the environmental issue. Only a scientist can say that.
It is possible for the scientists because they know about environmental hazards, and by doing research, they can find any remedy.
So, if the socioeconomic condition changes because of any environmental issues, it is not possible to solve by the government alone. Firstly, The government should take advice from scientists to reduce the effect of environmental problems. After reducing the effect of the issue, the government can think about changing its socioeconomic conditions.