1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
enot [183]
3 years ago
9

How many chromosomes are in each of Chester's sperm cells?​

Biology
1 answer:
kap26 [50]3 years ago
5 0

<h3>Each secondary spermatocyte completes the second meiotic division without the replication of DNA and produces 2 spermatids each containing 23 chromosomes. Spermatids undergo morphologic alteration (spermiogenesis) to become mature spermatozoa.</h3>
You might be interested in
People can breed cats for specific traits such as coat color through the process of _____. a. natural selection b. descent with
RSB [31]

Answer:

D. Artificial Selection.

Explanation:

Normal people can't breed cats by modifying their DNA, so options b and c are eliminated. Breeding cats for specific traits is not natural, so it is not choice a, either. Instead, selective breeding is d. artificial selection.

Hope this helps!

8 0
3 years ago
Which animal does not belong in class Gastropoda?
notsponge [240]
I would say E. whelks

4 0
3 years ago
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
3 years ago
Which of the following environmental problems could be solved by reducing the amount of packaging that people need to throw away
mezya [45]

Answer:

the anserw is B

Explanation:

Becuse landfill conant garbeg and can overfill.

4 0
3 years ago
Read 2 more answers
Protein synthesis is a multistep process. put the steps of protein synthesis in sequential order.
wlad13 [49]

Answer:

Replication - Transcription - Translation

Explanation:

Replication duplicates the DNA so that happens first. Then in transcription converts the DNA to mRNA which goes to the cytoplasm to make proteins. In translation proteins are made when codons and anti codons join to make amino acids which create the proteins.

6 0
2 years ago
Other questions:
  • The hyoid bone, which anchors the tongue, is included in the _____ skeleton.
    8·1 answer
  • Out of these people who r ur favs?
    5·1 answer
  • In the chemical process of photosynthesis, water is a
    10·2 answers
  • In a food web, energy is transferred from one organism to another. As energy moves between the trophic levels, only a small amou
    12·1 answer
  • A group of environmentalists were discussing the benefits and drawbacks associated with using fossil fuels. Which argument best
    5·2 answers
  • True or False: Food Webs are generally more accurate and detailed models of an ecosystem than Food Chains.
    9·2 answers
  • Enzymes break down large molecules to yield smaller molecules.
    9·2 answers
  • A hydraulic system uses a(n) ____________________ to transmit pressure.
    9·2 answers
  • Strep throat and bacterial pneumonia are examples of __________.
    7·2 answers
  • What are viable explanations for the consistent observation of a few black mice on the island?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!