1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Tcecarenko [31]
3 years ago
7

I need help i’ll mark brainlyist.

Biology
1 answer:
pav-90 [236]3 years ago
7 0
1. Alkaline
2. Alkaline earth
3. Alkaline earth
4. Transition
5. Alkaline
You might be interested in
PLEASE HELP!!!
lisov135 [29]
A.
Glad I could help!
5 0
3 years ago
Read 2 more answers
Lizard scale coloration has a complete dominance relationship where green scales are dominant to blue scales. There are 1536 gre
krek1111 [17]

Answer:

The frequency of individuals with the recessive genotype is 0.04

Explanation:

Due to technical problems, you will find the complete explanation in the attached files.

Download pdf
5 0
3 years ago
What is cell organization
svetoff [14.1K]
I really don't know but I know that its part of your body
3 0
4 years ago
What is the mRNA that would be transcribed from this strand of DNA?
Illusion [34]

Answer:

AUGUUAGUUCGUGAACGUUCUGAUUAA if its rna transcription and replace the U's with T's if its dna replication

Explanation:

8 0
2 years ago
How do astronomers think the sun may have begun?
borishaifa [10]
They tried to connect the idea of stars with the sun
8 0
3 years ago
Other questions:
  • How do you think seeing this x-ray image affected the work of Watson and Crick? It was used to ... A show that DNA was the molec
    15·1 answer
  • What is the most specific taxonomic grouping in which all three cats are the same
    13·2 answers
  • Can anyone please help me on this at least some
    9·1 answer
  • Which phylum of fungi consists of decomposers that utilize flagellated spores? A. Chytridomycota B. Ascomycota C. Zygomycota D.
    11·1 answer
  • Answer please ????? I will appreciate it
    15·2 answers
  • What should be included in an experimental design because of the way data is analyzed using statistics?
    7·2 answers
  • Which statement describes the relationship between transcription and translation?
    7·2 answers
  • A small population of white-footed mice has the same intrinsic rate of increase (r) as a large population. If everything else is
    9·1 answer
  • All the members of specific species that live in an area are
    9·1 answer
  • Which of the following describes a parasite
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!