1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Andrew [12]
3 years ago
8

The first unstable compound formed during C3 cycle is:

Biology
1 answer:
OLEGan [10]3 years ago
5 0

Answer:

(b) 2-carboxy,3-keto,1,5-biphosphorobitol

Explanation:

2-carboxy, 3-keto, 1,5-biphosphorobitol is the first unstable molecule formed during the C3 cycle. Due to its instability, this molecule is quickly broken down into two molecules each containing 3 carbon atoms, called 3-phosphoglyceric acid, this breakdown is done through water in a process known as hydrolysis.

You might be interested in
I don't usually ask questions for school, I'm just curious. Well, if you look up 'savant syndrome', you'll understand this bette
Gnesinka [82]

Answer:

yeah

Explanation:

everything is possible. thats why we scientists are here in this world. to create things for the benefit of mankind. i personally believe its possible

7 0
3 years ago
A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 20 million years. Examine th
IgorC [24]
Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.

Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT

These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations
5 0
3 years ago
How does natural selection support the theory of evolution?
madam [21]
Only the strongest live on to pass on their genes. the weak die
5 0
3 years ago
Why is it important for the cell membrane to allow materials to enter and leave the cell
umka21 [38]
<span>Cell membrane needs to allow and exit the materials that enter the cell because the cell needs nutrients and these nutrients are converted into molecules that aid in many cellular activities like repair, divide and form structures and biomolecules.
Also to excrete wastes and other harmful materials for the cell.
This continues because the cell wants to attain homeostasis.

Homeostasis is the state where the internal and external part of the body maintains and establishes balance and equilibrium. This is achieved through cellular processes in the body, the integumentary system regulates the body temperature, the hypothalamus –hunger and thirst of the individual and other interrelated organ systems that make the body healthy and in the state of equilibrium. Now, when diseases or disorders appear they disrupt the organ systems in the body thus, causing imbalance state –high fever, inability to focus and etc.<span>
</span></span>
5 0
3 years ago
Fires are important to savanna ecosystems but not grasslands
Akimi4 [234]
The correct answer for the question that is being presented above is this one: "FALSE." <span>Fires are important to savanna ecosystems but not grasslands. </span><span>Well this would be false, considering that savanna are the same as grasslands. More or less they are the same.</span>
7 0
3 years ago
Read 2 more answers
Other questions:
  • Which question can be answered using the scientific process?a. how long does it take a paper bag to break down?b. should people
    14·2 answers
  • Which of these choices is a disadvantage of the endangered species act ?
    8·2 answers
  • Which layer of earth is like the shell of an egg?
    13·2 answers
  • This is a requirement for natural selection to occur.
    15·2 answers
  • What are two things that cause ocean waves?
    13·1 answer
  • Why do paramecia have cilia?
    14·1 answer
  • When you are in the resistance stage of stress your body is blank damage caused in the alarm stage?
    6·1 answer
  • Which of the following is an example of a population?
    13·2 answers
  • Living organisms include bacteria, fungi ,plants, and animals . What is one thing that all living things have in common?
    15·1 answer
  • Property of water that makes transpiration to occur
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!