1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
omeli [17]
3 years ago
11

A key prediction/implication of evolutionary theory is that:

Biology
1 answer:
Valentin [98]3 years ago
4 0

Answer:

-all species change gradually over time.

Explanation:

Mutation often results from cell replication and division. These occur as small, random, errors within the genetic code that become more common or stable within a population over time as traits.

As organisms live within varying niches, environmental changes may render some genetic traits obsolete. However, others may become more beneficial as an adaptation. These adaptations, which make an organism and its offspring suited to a niche, and more likely to survive and reproduce become inherited- this process is called evolution.

You might be interested in
Explain what is ecological conservation and conservation of the environment. What can you do to conserve the environment? Why do
den301095 [7]

Answer:

Conservation ecology is the branch of ecology and evolutionary biology that deals with the preservation and management of biodiversity and natural resources. Its goal is to find ways to conserve species, habitats, landscapes, and ecosystems as quickly, as efficiently, and as economically as possible.

-These are some examples of how we can conserve the environment:

Recycle your rubbish and participate in or help organize recycling campaigns.

Avoid littering and participate in or help organize litter clean-ups (here you can link to a website for volunteering or starting your own beach clean-up).

Use less plastic by, for example, carrying a reusable water bottle, saying no to disposable straws and cutlery, avoiding plastic toys, and bringing your own shopping bags (for further ideas on a plastic-free life take a look here).

Swap toys, movies, and books instead of buying new ones.

Donate, recycle, and repair electronic devices (see how here).

Use less water when brushing teeth, taking a shower, or washing the dishes.

Use less electricity by turning off lights and electronic devices when not in use, using energy-saving light bulbs, and hanging clothes to dry.

Use public transport, share a journey with friends (e.g., car-sharing), cycle, or walk when possible.

Use less paper by not printing unnecessary things and reading e-books.

Turn down the air conditioning when it is hot and use fans if you are still hot-they use much less power.

Turn down the heat when it is cold and use sweaters, blankets, and socks to keep warm.

Do not waste food and try to buy food that is grown locally and in season.

Hope this helps:)

8 0
3 years ago
How many rounds of dna replication are there in a meiotic cell cycle?
RUDIKE [14]

Answer:

Two rounds

Explanation:

Meiosis is characterized by one round of DNA replication followed by two rounds of cell division, resulting in haploid germ cells. Crossing-over of DNA results in genetic exchange of genes between maternal and paternal DNA.

7 0
3 years ago
Marathon runners typically will eat foods high in carbs 2-3 days before they run the race. This allows them to have large stores
Luden [163]
I think the answer is A
6 0
3 years ago
A friend of yours claims to have identified a gene that causes a human disease! Your friend says that they have sequenced the DN
sattari [20]

Answer: Point mutation is easily reversible, thus non-lethal

Explanation:

Point mutation is caused by exchange of a single nucleotide for another. These change is called

1) Transition (when a purine base substitute another purine base, or pyrimidine bases substitute each other)

2) Transversion (when a purine base substitute a pyrimidine base).

However, note that a point mutation can be easily reversed by another point mutation; so, the claim that a nucleotide difference in the Hsr12 gene caused the human disease is inaccurate

3 0
3 years ago
If a scientist is studying the attraction of water molecules to each other, what property is he or she studying?
gtnhenbr [62]

Answer: Cohesion

Explanation:

The cohesive attraction or cohesive forces is the action or property of like molecules which stick together.

It can be intrinsic forces that can be caused by the structure and shape of water. This allows the water molecules to stick to each other.

Due to this phenomenon of water it has a spherical shape and it flows in a liner motion.

Hence, the force that is present between two water molecules is cohesion.

8 0
3 years ago
Read 2 more answers
Other questions:
  • What term describes chromosomes that exist in cells as homologous pairs?
    6·1 answer
  • The ability of your body's immune system to distinguish between your cells
    13·1 answer
  • Passive transport can only occur when there is a concentration gradient of low to high for a substance?
    8·1 answer
  • In your own words explain how a weather ballon can be used to predict-future weather conditions in a location
    7·1 answer
  • Why do phospholipids form a bilayer in water?
    6·1 answer
  • The cells of multicellular organisms are
    11·1 answer
  • If a plant develops a toxin, how might an herbivore evolve in response?
    7·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • An increase in which of the following factors is likely to contribute to competition between two members of the same species liv
    5·1 answer
  • Describe a situation in which a bacteria-free environment would be desirable: not desirable:
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!