1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
omeli [17]
3 years ago
11

A key prediction/implication of evolutionary theory is that:

Biology
1 answer:
Valentin [98]3 years ago
4 0

Answer:

-all species change gradually over time.

Explanation:

Mutation often results from cell replication and division. These occur as small, random, errors within the genetic code that become more common or stable within a population over time as traits.

As organisms live within varying niches, environmental changes may render some genetic traits obsolete. However, others may become more beneficial as an adaptation. These adaptations, which make an organism and its offspring suited to a niche, and more likely to survive and reproduce become inherited- this process is called evolution.

You might be interested in
Helpppp!!
Georgia [21]
This is it.,, the answer you have been waiting for.

5 0
4 years ago
Use the image on the right to match the following
Fed [463]

Answer:

School of orange fish-population

fish, starfish, coral, plants, rocks, and water- ecosystem

starfish- organism

fish, starfish, coral, and plants- community

8 0
4 years ago
Read 2 more answers
Help this is due in 30 minutes. Could a Type B child with a Type A mother have a Type A father? Explain.
tekilochka [14]

no

cuz both are type A so the child has to be a type A

4 0
3 years ago
Read 2 more answers
The human male reproductive system
Tanya [424]

Answer:

              B) I and II

Explanation:

                     Male reproductive system produce gametes in the testis which is the part of male reproductive system. Testis are two in number normally which compose of seminiferous tubules which have spermatogenic cell which are responsible for the production of spermatids with the help of sertoli cells present in the seminiferous tubules.After production  of gametes the spermatid are delivered to the female reproductive system by copulating organ which in human is penis.the sperm 1st produces in the semeniferus tubules then transfer in to the rate testies ,epidydemis then vas deference and then urethra and then outside the body.

4 0
3 years ago
Are gypsy moth consumers, decomposers, or producers
svetlana [45]
Gypsy moths are consumers because they consume flower nectar and juice from rotten fruits.
3 0
3 years ago
Read 2 more answers
Other questions:
  • What is the change in number of individuals in a population over time? A. population decrease B. population stability C. populat
    6·2 answers
  • During soccer practice, sadie tripped and tried to stop her fall with her outstretched arms. her humerus broke and the broken en
    7·1 answer
  • What specific classification do humans have a tigers
    15·2 answers
  • What is the role of the greenhouse gases in the atmosphere?
    5·1 answer
  • Who created Photo 51 ?
    6·2 answers
  • What’s a watt?
    11·1 answer
  • 5. Mrs. Weasley has Type A blood but she is not sure if she is homozygous or
    10·1 answer
  • The graph shows world fish production from both wild capture and aquaculture. What would happen if a genetically modified fish t
    11·2 answers
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • How much of the sun's energy is Absorbed by earth​
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!