1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
olchik [2.2K]
2 years ago
12

PLEASE HELP show the calculation of the number of neutrons of hydrogen​

Physics
1 answer:
xz_007 [3.2K]2 years ago
7 0
The answer is 2.3 hope this helps texted me and tell me if it’s right
You might be interested in
What does a fire burn a hole right in the middle of the chair???
earnstyle [38]

i dont understand wat ur tryna say ma dude but whatever it is its.............PIZZA

4 0
3 years ago
"the number of transistors per square inch on an integrated chip doubles every 18 months." this observation is known as ________
creativ13 [48]
That is called Moore's Law
5 0
3 years ago
I need to match the nitrogenous base with its complementary base pair from one strand: ATTGGCCATTGGAATACCAGTCGAGGCCACCGAGGCCTTAC
igor_vitrenko [27]

Explanation:

Well A-T have a complementary shape

And C-G have a complementary shape

So replace all Ts for A, and all As for Ts

Replace all Cs for Gs, and all Gs for Cs

You get"

TAACCGGTAACCTTATGGTCAGCTCCGGTGGCTCCGGAATG

7 0
3 years ago
A skier, starting from rest, slides down an icy frictionless 80o incline whose vertical height is 105 m. How fast are they going
leonid [27]

Answer:

nadaáaaaaaaaaaaaaa aaaaaaaaaaaaaaa

4 0
3 years ago
If you travel 5 miles north then turn and travel 5 miles south, you have traveled ______ miles
DedPeter [7]
You have traveled 10 miles
7 0
3 years ago
Read 2 more answers
Other questions:
  • An electron in the n = 6 level of the hydrogen atom relaxes to a lower energy level, emitting light of λ = 93.8 nm .find the pri
    14·2 answers
  • A toroid having a square cross section, 5.00 cm on a side, and an inner radius of 15.0 cm has 500 turns and carries a current of
    13·1 answer
  • Which part of the electromagnetic spectrum generally gives us our best views of stars forming in dusty clouds?
    9·1 answer
  • What collides and creates a movement of heat called conduction?
    13·1 answer
  • You set your stationary bike on a high 80-N friction-like resistive force and cycle for 30 min at a speed of 8.0 m/s . Your body
    14·1 answer
  • If the value of the electric field in an electromagnetic wave were doubled then
    6·1 answer
  • A uniform disk with radius 0.650 m
    5·1 answer
  • The mass of a truck with its cargo is 1800 kg. The truck is coasting to the right with a speed of 10 m/s. As it coasts its cargo
    15·2 answers
  • what is the best way to increase the rate of evaporation a.increase temperature b. decrease temperature c. decrease surface area
    14·2 answers
  • A car drives around a racetrack for 30 seconds. What do you need to know to
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!