1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Natali [406]
3 years ago
12

Help please biology

Biology
2 answers:
labwork [276]3 years ago
8 0
A cause the mitochondria is the power house. vacuoles absorb the pigment. the nucleus deals with the blood
Lana71 [14]3 years ago
3 0
The answer should be: Lysosomes contain enzymes to breakdown damaged cellular material.
You might be interested in
How can simple molecules impact an organism’s ability to function normally ?
serg [7]
The functional groups determine the shapes of macromolecules and this in turn determines their functions
3 0
3 years ago
Mammals are diphyodont which refers to the fact that
natulia [17]

The correct answer is D. They have two successive sets of teeth including milk teeth and permanent adult teeth

Explanation:

In biology, a diphyodont is an animal that has two different sets of teeth, this often means the animal has a set of baby teeth that are later replaced by permanent teeth, this occurs in most mammals including humans. Additionally, diphyodont differ from other types of animals that have either only one set of teeth (monophyodonts), for example, toothed whales or change their teeth permanently (polyphyodont), for example, crocodiles. Thus, mammals are diphyodont because "they have two successive sets of teeth including milk teeth and permanent adult teeth".

8 0
3 years ago
10 points! When looking out of my back door, I see robins, blue jays, finches, crows, hawks and owls all living in the same area
forsale [732]

The possibility for all of the mentioned birds to live all in a same area is because they are all specialized and occupy a certain niche in the food chain, thus not standing in each others ways when it comes to competition for food.

All of these birds have adapted to be able to survive in their respective environment, developing characteristics that will enable them to be superior in something. Through natural selection, the individuals that were performing better, got the chance to mate, thus the offspring was better adapted and stronger in its niche of the food chain.

The robins and the blue jays are birds that are very opportunistic in their food choice, thus giving them greater flexibility and ability to survive, they mostly feed on worms, insects, fruits, vegetables, so they have a big menu.

The finches are specialized in eating nuts and seeds, thus avoiding the competition with the previous two, thus having that food type for themselves.

The owls and hawks are both birds of pray, but the owls hunt mostly at night, while the eagles during the day. Also, the owls prefer to have rodents as their pray, while the hawks are mostly eating other birds, thus not standing in each other's ways.

8 0
3 years ago
In Labrador dogs, black coat is dominant to chocolate, normal vision is dominant to progressive retinal atrophy (PRA), and norma
AVprozaik [17]

Answer:

In Labrador dogs, black coat is dominant to chocolate, normal vision is dominant to progressive retinal atrophy (PRA), and normal hip joint is dominant to hip dysplasia. All these genes assort independently. Two dogs that are heterozygous for alleles of all three genes are crossed. Using rules of probability (not a Punnett square), what is the chance that the first pup born to these dogs will be chocolate, have normal vision, and have normal hip joints?

BbVvHh x BbVvHh= BBVVHH, BbVvHh, BbVvHh, bbvvhh

Bb= black coat dominant

Vv= Normal vision dominant

Hh= Normal hip join dominant

probability of having a first born of these dogs will be chocolate, have normal vision and have normal hip joint is 0

Explanation:

As the punette square gives 3:1 phenotype having three black coat, normal vision and normal hip joint and one chocolate, progressive retina altropy and hip dysplasia

3 0
3 years ago
What is the function of Nucleic Acids?
Tanya [424]
They contain genetic information and assist in making proteins
8 0
3 years ago
Other questions:
  • 6. What is a controlled experiment? *
    15·1 answer
  • What is the process in which a glacier drags rocks along the landscape
    14·1 answer
  • How many valence shell electrons does the element carbon have
    6·1 answer
  • What would happen if our atmosphere consisted of pure oxygen
    9·2 answers
  • Why can’t you drink salt water?
    8·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • A learned predisposition to respond cognitively, affectively, and behaviorally to a particular object is known as _____.
    11·1 answer
  • In 3–5 sentences, describe flood mitigation techniques the federal government might use.
    12·1 answer
  • I WILL GIVE BRAINLIEST!!
    9·1 answer
  • Most plants have what type of photoperiodism?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!