1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Yuri [45]
3 years ago
5

Mr. Allenby spent​ $34 for 6 movies. If each movie is the same​ price, how much would he have to spend for 24​ movies?

Mathematics
2 answers:
lana [24]3 years ago
5 0

Answer: I think it $136

Step-by-step explanation:

12345 [234]3 years ago
3 0

Answer:

$136

Step-by-step explanation:

If Mr. Allenby spent $34 on 6 movies we know that each movie costed roughly $5.67

(34 / 6 = 5.666...)

Knowing this we can multiply $5.67 by 24 which equals $136

(5.666... x 24 = 136)

You might be interested in
Round 21 to the nearest 10.
bagirrra123 [75]

21 rounded to the nearest 10 is 20 :)

4 0
3 years ago
Read 2 more answers
Which linear equation has a negative slope? А y = 6 в у= y = – 50 y = 2x + 5​
iris [78.8K]

Answer:

y = - 50

Step-by-step explanation:

m = slope

5 0
3 years ago
Read 2 more answers
Plzzzzzz help I am going to fail unless I get the answer. Brainly says my answer will be answered right away I have had these up
mina [271]

Answer:

I think it's 6?

7 0
2 years ago
Using dimensional analysis, what unit of time will make the statement true?
frosja888 [35]

The unit of time that will make the statement true is "day"

<h3>What unit of time will make the statement true?</h3>

The conversion equation is given as:

Seconds + Seconds/? * day = seconds

Represent the blank with a variable (x)

So, we have:

Seconds + Seconds/x * day = seconds

Subtract "seconds" from both sides of the equation

So, we have:

Seconds/x * day = seconds

Divide both sides of the equation by "seconds"

So, we have:

1/x * day = 1

Multiply both sides by x

x= day

Hence, the unit of time that will make the statement true is "day"

Read more about time at:

brainly.com/question/17146782

#SPJ1

4 0
2 years ago
A population increases 3% each year. If the city is now 5 million, what will the population be in 5 years?
Step2247 [10]
5 million x 3% = 150,000
1 Year = 5,150,000

5.15 million x 3% = 154,500
2 Years = 5,304,500

5,304,500 x 3% = 159,135
3 Years = 5,463,635

5,463,635 x 3% = 163,909.05
4 Years = 5,627,544.05

5,627,544.05 x 3% = 168,826.322
5 Years = 5,796,370.37

After 5 years, the population will be 5,796,370.37
8 0
3 years ago
Other questions:
  • Which is not a solution to tho equation 4x-y=5
    13·1 answer
  • Are the following figures similar?
    12·2 answers
  • A golfer hit a ball from a tee that is 6 yards above the ground. The graph shows the height in yards of the golf ball above the
    15·1 answer
  • Directions: Six contestants on a reality TV show were stunned to find their lowest scoring colleague was “murdered”. You must fi
    13·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • Mitch and his brother Austin started at their house and biked 8 kilometers west and 14 kilometers south. If they could take a st
    12·1 answer
  • Evaluate the expression for the given value of x 3x-4;x=7
    12·1 answer
  • What is the first step when factoring the trinomial .,
    5·2 answers
  • Please solve both questions in exact form (no decimals) with explanation of how you solved it. Answer quick, will mark as Brainl
    11·1 answer
  • Please help me again!! I can't decide which one it is...
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!