1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Monica [59]
3 years ago
8

True or False: Decomposers do NOT need energy to live.A. TrueB. False​

Biology
1 answer:
Maksim231197 [3]3 years ago
3 0

Answer:

False

Explanation:

Consumers (animals) get their energy by eating the producers and/or other consumers. Scavengers and decomposers get their energy by eating dead plants or animals. Living organisms require these nutrients to create cells, tissues and to provide energy for life processes. Thus, all living things need energy to survive.

You might be interested in
What abiotic factors affect the<br> oceans?
mestny [16]
Abiotic factors include sunlight, temperature, moisture, wind or water currents, soil type, and nutrient availability. Ocean ecosystems are impacted by abiotic factors in ways that may be different from terrestrial ecosystems.
6 0
3 years ago
12345678910 ________________ are hypotheses that are supported by repeated experiments. A) Theories B) Postulates C) Dependent v
umka21 [38]
The answer is theories
6 0
4 years ago
What is the U.S. Ocean Dumping Ban Act of 1988?
Bumek [7]

Answer:

Ocean Dumping Ban Act of 1988 - Title I: Ocean Dumping of Sewage Sludge and Industrial Waste - Amends the Marine Protection, Research, and Sanctuaries Act of 1972 to prohibit all dumping of sewage sludge and industrial waste into the ocean after 1991.

Explanation:

...

4 0
3 years ago
In fruit flies, gray bodies (G) are dominant over black bodies (g), and brown pigments (N) are dominant over yellow pigments (n)
lisabon 2012 [21]

Answer:

(Gg) and (Nn)

Explanation:

homozygous dominate means two of the dominate traits (GG) (NN)

while homozygous recessive would be like (gg) (nn)

hope this helps ???

3 0
4 years ago
Which two elements are<br><br>mainly found in the inner<br><br>and outer core?
sattari [20]
The solid inner core is made of mainly iron crystals with small amounts of nickel and heavier elements such as gold and platinum. The liquid outer core is a nickel iron alloy with small amounts of heavier elements.
5 0
3 years ago
Other questions:
  • A balance between gravity pulling atoms toward the center and gas pressure pushing heat and light away from the center is called
    13·1 answer
  • What does a ripened ovary develop into in a flowering plant?
    5·1 answer
  • Which substance is a compound? A. Water B. Gold C. Oxygen D. Hydrogen
    7·2 answers
  • What is the DNA compliment to the given strand TACGTATGCCGTATGGGCATT
    13·1 answer
  • Identify the types of reproduction represented in the images.
    7·1 answer
  • What types of cells can our bodies no longer produced
    11·1 answer
  • A mechanism by which cancer cells can evade an immune response involves an alteration in the amount of MIC on the cell surface b
    14·1 answer
  • Which is correct<br><br> Science
    13·1 answer
  • If a wolf eats a herbivore, the energy is transferred ________.
    12·2 answers
  • Which ball-and-stick model represents a molecule of similar atomic composition to carbon dioxide (CO2)?​
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!