1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
german
3 years ago
13

100 points if you answer this!PLEASEE

Biology
1 answer:
Elodia [21]3 years ago
5 0

Answer:

a mountain top mam

Explanation:

You might be interested in
Can someone tell me , what's special about genetical engineering ?​
Nitella [24]

Answer:

By knocking out genes responsible for certain conditions it is possible to create animal model organisms of human diseases. As well as producing hormones, vaccines and other drugs , genetic engineering has the potential to cure genetic diseases through gene therapy.

Explanation:

Believe it!!

5 0
3 years ago
Read 2 more answers
What are two organelles you would expectto find highly in a cell that produces a lot of proteins
Vanyuwa [196]
Small, highly concentrated cell organelles that produce proteins are called <span>ribosomes. Ribosomes can be free-floating or attached to endoplasmic reticulum.</span>
3 0
3 years ago
In an Island ecosystem, fox and skunks both hunt mice and toads. Which of the following correctly describes some of these relati
Vlad1618 [11]
I'd say the answer to this one is B, skunks and toads have a predator-prey relationship. Good Luck!
3 0
3 years ago
Read 2 more answers
Emily enjoys experimenting with color changing lizards. She places a green lizard on a brown background and a brown lizard on a
Katena32 [7]
They all sound right, but id go with A
3 0
3 years ago
Can someone pls check
Schach [20]

Mitosis only

OPTION A

Mitosis is simply the process of cell division.

Meiosis is the process of producing gametes (eggs and sperm), which is important for sexual reproduction.

8 0
3 years ago
Other questions:
  • How does a fungus get energy
    5·1 answer
  • what digest and recycle the cell's used components by breaking down proteins, nucleic acids, lipids, and carbohydrates.
    8·1 answer
  • What is the texture and consistency of the dna? 2. why did we use a salt in the extraction solution? 3. is the dna soluble in th
    10·1 answer
  • Which of the following is a prediction created based on the background information and observations?
    8·1 answer
  • A body of air in the atmosphere that has mostly constant temperature, humidity, and pressure is…
    14·2 answers
  • Data mining contributes to the field of
    15·1 answer
  • The statement 2 + 2 = 4 would be considered a _____ in the science world
    14·1 answer
  • How does light from stars indicate the universe is expanding?
    8·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • You are trying to find which wavelength of light would allow algae to do photosynthesis the worst (you want to prevent algal gro
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!