1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
julia-pushkina [17]
3 years ago
9

What is the full form of ATP?​

Biology
2 answers:
GenaCL600 [577]3 years ago
8 0

Answer:

Adenosine triphosphate

hope it helps DD

german3 years ago
6 0

Answer:

ATP stands for Adenosine triphosphate, an organic molecule responsible for driving nearly all cellular mechanisms and processes in living organisms. Hence, biologists often refer to ATP as the “energy currency of the cell.”

You might be interested in
1. How does the principle of conservation of mass relate to chemical reactions?
Mademuasel [1]
Hope this helps for number 2 not worried about points

A chemical reaction can be described by discussing the chemical substances at all steps. It is more efficient to use a chemical equation than words, and there are agreed-upon conventions to summarize the reaction, the substances that take part in it, the products, and the amounts
7 0
4 years ago
A) (1 pt) Based on the data in Figure 1, identify which of
Sladkaya [172]

Answer:

Friedreich ataxia is inherited in an autosomal recessive manner.

Explanation:

Autosomal recessive disorder is a type of disorder which occurs only when abnormal genes are present in both cells. Autosomal recessive is a method through which disease is passed from parents to offspring. Friedreich's ataxia is a genetic disease that is very rare which causes difficultly in movement from one place to another, a loss of sensation in the arms and legs, and speech in the patients.

7 0
4 years ago
Why do levels of photosynthesis change based on location and time of the year?
NARA [144]

Answer:

Because of the Earths rotation

Explanation:

Hope this helps

3 0
3 years ago
Read 2 more answers
Drosophila eye color is an X-linked trait. Red eye color is dominant, and white eye color is recessive. Which Punnett square sho
boyakko [2]

Answer:

The correct answer is A (XRXr, XRXr, XRY, XRY) becouse

R- is about red color

r- is about white color 

if we have Rr ( XRXr)- that will be red color 

white color is only when is only "r" (XrY) or only "rr"  ( XrXr)

Explanation:i put this in the wrong place and im sorry

3 0
4 years ago
Question 2 of 10
umka21 [38]

Answer: Death Rate.

just did the quiz on apex

Explanation:

6 0
3 years ago
Other questions:
  • According to the graph, how is pH affecting enzyme activity?
    6·2 answers
  • Which of the following statements regarding the primary versus the secondary immune response is true?
    7·1 answer
  • How to recognize when two chromosomes are homologous?
    15·1 answer
  • Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
    6·1 answer
  • What is always true of a binary compound? A-It has two elements B-It has two atoms C-It has a double bond D-It has covalent bond
    7·2 answers
  • Jia observes that adding a solution of sodium hydroxide to a clear liquid turns the liquid pink. She makes a hypothesis about wh
    6·1 answer
  • An antibiotic is a type of medication that cures infectious diseases. Why does the word antibiotic suggest that these medication
    7·2 answers
  • Is it true that artificial selection occurs when nature selects for benificial traits?
    14·1 answer
  • I need an answer asap!!!!! what happens to carbon atoms during photosynthesis please helppp?
    12·1 answer
  • The oceans help regulate climate and clean up pollutants.<br> O True<br> O False
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!