1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sashaice [31]
2 years ago
5

Which arthropods are a part of the class maxillopoda?

Biology
1 answer:
kifflom [539]2 years ago
7 0

Answer:

a) Maxillopoda is a diverse class of crustaceans including barnacles, copepods and a number of related animals. It does not appear to be a monophyletic group, and no single character unites all the members

b) General Characters of Hexapoda (Insects)

Ø A large taxa, includes insects and a small group of wingless arthropods.

Ø Body plan: 3 parts, head, thorax and abdomen.

Ø Head with six segments.

Ø Thorax with three pairs of jointed legs (hence the name hexapoda)

Ø Head bears a presegmental acron.

Ø Acron bears compound eyes.

You might be interested in
Earth's early atmosphere probably did not have ozone,so many _________ in the air and at the Earth's surface were broken apart.
DochEvi [55]
I think it the answer could be a "steamy mixture of carbon dioxide and water vapor". 
7 0
3 years ago
Help please 20 points i mark u as brainlist
Artyom0805 [142]

Answer:

a. Mastication process and formation of bolus in the oral cavity

b. The contraction in the stomach breaks the food down into smaller pieces. These pieces are then moved to the small intestine.

c. In the small intestine, food particles are broken down into nutrients, fat, protein and carbohydrates which are absorbed into the bloodstream.

Explanation:

a. First step of digestive system functioning is the mastication process and formation of bolus in the oral cavity.

b. The contraction in stomach, with the help of digestive enzymes and acids, break the food down into smaller pieces. The small pieces of food are then released into the first part of the small intestine (duodenum).

c. In the small intestine, two enzymes released from pancreas and gall bladder break down the food particles into fats, proteins, and carbohydrates. Thereon, nutrients and carbohydrates, proteins and fats are absorbed into the bloodstream.

5 0
3 years ago
RNA is used in the process of translation to build proteins. Which of these correctly describes the role of the different types
navik [9.2K]

Answer:

A) rRNA makes up the ribosome.

B) tRNA carries amino acids to ribosome.

E) mRNA code is read to determine the sequence of amino acids in the protein.

Explanation:

6 0
3 years ago
In which of these stages is mitosis most important?
liberstina [14]
Where are the options?
7 0
2 years ago
Read 2 more answers
Which organsms can produce the highest number of geneticallly different gametes
enot [183]

Answer:

A Carp and Giraffes

3 0
3 years ago
Other questions:
  • A(n) ________ condition refers to a limit on the generalizability of a particular research conclusion.
    12·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • One of the questions early geneticists had to answer was how only four nucleotides can specify placement of 20 amino acids in pr
    7·1 answer
  • The ___ in the limbic system stores and stores new information.
    14·1 answer
  • Can genetic material in a plant cell be found in ribosome
    13·2 answers
  • Can anyone help me with this question??<br> Help!!
    12·1 answer
  • Mark you brainelest if you get this question right. At a convergent boundary between continental and oceanic crust, what feature
    15·1 answer
  • ACILIS<br>.<br>1. (a) State 5 economic uses of cocoa​
    6·1 answer
  • Please help with d and explain
    8·1 answer
  • Do you favour or oppose the use of animal organs (such as hearts or kidneys) as transplants in humans when human organs are not
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!