1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Whitepunk [10]
3 years ago
12

Genes a and b are 10 map units apart, b and c are 20 map units apart, and a and c are 30 map units apart. If a triple heterozygo

te is testcrossed, among 1,000 progeny, how many are expected to result from double crossovers if there is no interference?
а. 10;
b. 20;
c. can't be determined
d. 30;
e. 60;
Biology
1 answer:
Stells [14]3 years ago
6 0

Answer:

20 ( B )

Explanation:

Given data:

a and b are 10 map units apart

b and c are 20 map units apart

a and c = 30 map units apart

<em>condition </em>; Triple heterozygote testcrossed

number of progeny = 1000

<u>Determine the number of double crossover result </u>

P( crossover between a and b ) = 10/100 = 0.1

P( crossover between b and c ) = 20/100 = 0.2

p( double crossover ) = 0.1 * 0.2 = 0.02

hence number of double crossovers = number of progeny * 0.02

                                                              = 1000 * 0.02 = 20

You might be interested in
On a molecular level why does lifting weights consume energy
Veronika [31]

Answer:

to contract a muscle, myosin and actin filaments shorten, requiring ATP binding and hydrolysis

Explanation:

hopes it help

3 0
2 years ago
If two objects are moving at a constant speed with the same velocity, what will make the
Charra [1.4K]

Answer:

<em>The velocity can change by changing the direction</em>

Explanation:

If the direction changes, then the velocity changes even though the speed is constant. Hope this helps!

4 0
2 years ago
What are some factors that can increase or decrease the heart rate and the beat you feel at each pulse point?
Amanda [17]
One factor is resting and exercising
stress and peace
4 0
3 years ago
During the process of photosynthesis,
TEA [102]

Answer:

d. less than 100% of the energy captured from sunlight is transformed into potential energy in the form of a hydrogen ion gradient and then into potential energy in the form of covalent bonds

Explanation:

Photosynthesis is process utilized by plants, several bacteria and protists to convert the light energy to chemical energy. So they utilize the photosynthesis as the powerhouse for the energy production. Heterotrophs like human that cannot synthesize their own food, use this converted form of energy by autotrophs.

During the light reaction of photosynthesis the photons from light are absorbed by photosystem I and II. These photons excites the electrons which flow through the electron transport chain from higher potential to lower potential. These electrons release the energy while moving from higher potential to lower potential which is utilized by H+ pump to pump the H+ to lumen of plastids from stroma and of course not the 100% energy is utilized some of the energy dissipates. . So this process causes the accumulation of high potential H+ ions across the membrane. These H+ ions are utilized for the production of ATP by ATP synthase complex when they flow back to lower potential across the membrane through ATP synthase complex.

The ATP and NADPH produced from light reaction are utilized to combine carbon molecules during dark reaction. The covalent bond is used to combine the carbon molecules and we know that combining carbon molecules stores energy in the form of covalent bond.

8 0
3 years ago
Read 2 more answers
How did Renaissance Europe differ from medieval Europe
Mama L [17]
The Renaissance Europe differ from medieval Europe is by Populations shifted from cities to small towns and rural villages.

7 0
3 years ago
Read 2 more answers
Other questions:
  • 10. How many protons are in an element with an atomic number of 6 and a mass number of 12?
    9·2 answers
  • Amino acids are processed by the liver. <br><br> Describe this process.
    7·1 answer
  • When in the presence of sugar, Yeast perform wich process?
    10·2 answers
  • Select the correct words from the drop-down menus to complete the sentence. Metallic bonds are found in bronze between atoms of
    9·2 answers
  • Need help asap!!!!!!!!
    9·2 answers
  • The process where the organism with the best traits survives and passes on its DNA is:
    10·2 answers
  • 1. Based on the model, which of the pairs of
    5·1 answer
  • What is the mRNA in TACCGGATGCCAGATCAAATC?
    5·1 answer
  • ATP frequently acts as an energy source for organisms because?
    8·1 answer
  • What are some strength and weakness of cell membranes?
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!