1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
SpyIntel [72]
3 years ago
15

Please answer asap MUCH NEEDED!!

Chemistry
1 answer:
gulaghasi [49]3 years ago
3 0

Answer:

I think its C I am sorry if I am wrong

You might be interested in
Justin B. Believes that the temperature lowering during the fall months is what causes the color of the leaves to change. He set
Taya2010 [7]

Answer:

This question is incomplete, the remaining part of the question is:

What is the control group, independent variable and dependent variable?

Control group: Plants placed in 80 degree rooms

Independent variable: Change in temperature

Dependent variable: Change in color of leaves

Explanation:

The independent variable in a scientific experiment is the variable that the experimenter controls or manipulates in order to bring about a change in the dependent variable. In this experiment, the variable manipulated by Justin B is the TEMPERATURE CHANGE.

On the other hand, a variable is said to be dependent if it is the variable that responds to a change made to the independent variable or rather it is the outcome. In this experiment, Justin B is trying to see the outcome on the color change in leaves when exposed to a low temperature, hence, COLOR CHANGE IN LEAVES is the dependent variable.

Control group of an experiment is the group that receives no experimental treatment. It is the group the experimenter considers normal and hence is comparing with his experimental group. In this experiment, Justin B believes the leaves change color in a low temperature, hence, he placed some plants in a lower temperature (60 degree) in order to compare them with when the plants are placed in a higher temperature (80 degree). As far as this experiment is concerned, the plants placed in 80 degrees temperature are believed by Justin B not to undergo color change, hence, they are the CONTROL GROUP while the group he placed in 60 degrees temperature are what he is interested in, making them the EXPERIMENTAL GROUP

5 0
3 years ago
What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
valentina_108 [34]
TACCGAACGGTTCCAGGCCTTTCAAAG
3 0
3 years ago
The gram-formula mass of NO2 is defined as the mass of
ch4aika [34]
The correct answer is (1) one mole of NO2.

The gram formula mass is also known as the molar mass and is defined by the mass over one mole of a substance.

Hope this helps~
4 0
3 years ago
Read 2 more answers
A quantity of an ideal gas is compressed to half its initial volume. the process may be adiabatic, isothermal or isobaric. the g
JulsSmile [24]

the greatest amount of work is required if the process is adiabatic.The correct option is adiabatic.

The process in  which heat is constant is called adiabatic process.

The The process in  which temperature is constant is called isothermal process.

The process in  which pressure is constant is called isobaric process.

The P-V diagram for adiabatic , isothermal and isobaric process is given below.

Work done in process = area encloses by P-V diagram axis . Since area under the curve is maximum for adiabatic process which is shown in the above diagram. So, work done by the gas will be maximum for adiabatic process.

learn more about adiabatic process.

brainly.com/question/17192213

#SPJ4

3 0
11 months ago
Which of these is a property of bases?
Gwar [14]
They turn litmus paper blue
6 0
3 years ago
Read 2 more answers
Other questions:
  • What is the effect of adding a pre-made mix to alcohol?
    10·1 answer
  • PLEASE HURRY!! ONLY ANSWER IF YOU KNOW FOR SURE
    8·1 answer
  • If a 20.0mL test tube measures 15.0cm, what is the length in meters?
    9·2 answers
  • What are the conditions needed for hydrogen to react with iodine
    13·1 answer
  • Zinc is more active than cobalt and iron but less active than aluminum. Cobalt is more active than nickel but less active than i
    9·1 answer
  • An embankment is best defined as __________. A. the process of cutting down all of the trees and plant life in an area, with no
    10·2 answers
  • What is a primary difference between bacteria that are
    10·1 answer
  • Identify 3 characteristics that would be taken into consideration when evaluating any proposed site for a national repository of
    9·1 answer
  • How does the entropy of a geyser system change as energy is added to the system ??
    8·1 answer
  • 3. Describe short-term factors that could influence yearly data within this system
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!