1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
frozen [14]
3 years ago
9

Diagram of a bacteriophage​

Biology
2 answers:
kondor19780726 [428]3 years ago
6 0

Answer:

diagram of a bacteriophage​

Explanation:

Nutka1998 [239]3 years ago
6 0

Explanation:

hope it helps you...i. was not able to give clear photo so sorry

You might be interested in
Label the components of the activation of a helper t cell by a dendritic cell.
ira [324]

T cell receptor, Cytotoxic T Cell, CD4, Antigen, Bacterium, B – cell, Cell mediated response, Class II MHC, Cytokines, and Humoral Response are the components for the activation of a helper t cell by a dendritic cell.

8 0
3 years ago
What is the ecological system called that consists of all of its biotic and abiotic factors?
prisoha [69]

The ecosystem is an ecological system consisting of all of its biotic and abiotic factors

7 0
3 years ago
Read 2 more answers
A bacterium is infected with an experimentally constructed bacteriophage
dem82 [27]

The complete question is:

a bacterium is infected with an experimentally constructed bacteriophage composed of the T2 phage protein coat and T4 phage DNA. The new phages produced would have

A) T2 protein and T4 DNA

B) T2 protein and T2 DNA

C) a mixture of DNA and proteins of both phages.

D) T4 protein and T4 DNA

E) T4 protein and T2 DNA

A bacterium infected with an experimentally constructed bacteriophage will give new phages with the virus' DNA and the type of proteins that this DNA encodes.

A bacteriophage is a virus that attaches itself to a bacteria and uses it to replicate itself. Viruses have two main parts, a protein coat and their DNA inside it.

  • The experimentally constructed bacteriophage has one type of protein that makes the coat, the T2. This type of protein will allow the virus to attach and infect the bacteria.
  • Once the virus attaches itself to the bacteria, it will introduce its DNA, T4 type, and use the bacteria elements to replicate it and create new phages.
  • As a result, the new phages will have T4 DNA, and the proteins that the virus synthesizes will be the same type as the DNA.

In conclusion, The new phages produced would have D) T4 protein and T4 DNA.

Learn more at:

brainly.com/question/3901247

8 0
2 years ago
Which of these methods is NOT safe for thawing food?
stellarik [79]
The answer is b 
<span>1.Upper Epidermis – The upper surface of a leaf that protects the inner cells of the leaf. 2.Palisade Layer – Long, thin, tightly-packed cells where most photosynthesis takes place. 3. Spongy Layer – Loosely packed cells with many air spaces between them in order to allow carbon dioxide to pass among the cells and get to the chloroplasts. 4. Lower Epidermis – The bottom layer that protects the underside of the leaf and has many openings (stomata)</span>
3 0
3 years ago
Read 2 more answers
Co způsobuje malarii
butalik [34]

Malárie je způsobena parazity Plasmodium. Paraziti se k lidem šíří kousnutím infikovaných samic komárů Anopheles, nazývaných „vektory malárie“. Existuje 5 druhů parazitů, které způsobují malárii u lidí, a 2 z těchto druhů - P. falciparum a P. vivax - představují největší hrozbu

4 0
3 years ago
Other questions:
  • Skin and nerve cells have different appearances and characteristics from each other, although they contain the same DNA. Why?
    12·1 answer
  • Sometimes a few individuals are isolated from the rest of the population and can have very different gene frequencies. This is c
    6·1 answer
  • Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
    8·1 answer
  • Astrology is pseudoscience. What can you conclude about the claims made<br> by astrology?
    6·1 answer
  • Translation and protein synthesis is occurring at the ribosome. If the tRNA anticodon being matched at the ribosome is AUG, what
    15·1 answer
  • After the bite of the tsetse fly, parasites multiply in the blood of animals and _____.
    11·2 answers
  • 1. Patient c:
    14·1 answer
  • Which of these major bio element is present in the lowest amount in the body mass of living organism? *
    5·1 answer
  • The runner below has a mass of 55 kg and is moving at 3.87 m/s. what is his kinetic energy in joules
    7·1 answer
  • In man, brown eyes (B) are dominant over blue eyes (b) and normal skin pigmentation (N) is dominant over albinism (n). A brown e
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!