1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
slava [35]
3 years ago
11

Why is it important for DNA to remain in the nucleus?

Biology
2 answers:
Annette [7]3 years ago
7 0
The most important function of the nucleus is to store the cell's genetic information in the form of DNA. DNA holds the instructions for how the cell should work. DNA stands for deoxyribonucleic acid. The molecules of DNA are organized into special structures called chromosomes. Sections of DNA are called genes which hold hereditary information such as eye color and height. You can go here to learn more about DNA and chromosomes.
kkurt [141]3 years ago
5 0
DNA cannot leave the nucleus because that would risk it getting damaged.
You might be interested in
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
Parasitism describes a relationship between two organisms where: *<br> 1 point
abruzzese [7]

Answer:

Parasitism describes a relationship between two organisms where one gets benefit and other get harm.

Explanation:

Parasitism is a type of symbiotic association that is present between two different organisms. In association, one organism gets benefit from the other and the other is damaged. For example, association between mosquitoes and human is parasitism because mosquitoes get benefit in the form of food while human is damaged due to disease cause by mosquito biting.

4 0
4 years ago
Read 2 more answers
What is the name of the muscular layer in blood vessels.
AfilCa [17]

Answer:

tunica media hope this helps

3 0
2 years ago
Which phenotypic change is genetic?
Westkost [7]

B. The flower color in a population changes over time.
6 0
3 years ago
Read 2 more answers
Is it true that your organ systems do not interact with one another?
Tanzania [10]
That is not true because one you eat your body has to work together to digest the food.
7 0
3 years ago
Other questions:
  • Help please please help​
    8·1 answer
  • Which of these species is not endangered today thanks to successful conservation efforts? bald eagle polar bear Bengal tiger lea
    5·2 answers
  • play many roles in the body and determine many traits. In humans, is responsible for traits. Is the blueprint for proteins. The
    10·2 answers
  • Im lonely so pls help tell me why GOOD ANSWER
    15·2 answers
  • The term “autotroph” is almost synonymous with:
    11·1 answer
  • Explain the two main functions of the cell membrane in the cell
    15·2 answers
  • The purpose of cellular respiration is to _______
    10·2 answers
  • Which is an example of potential energy being transformed into kinetic energy?
    9·1 answer
  • Describe the three structural components of an rna nucleotide monomer.
    12·1 answer
  • The center of our galaxy contains a very intense source of radio and x-ray radiation named sgr a*. what is it about this source
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!