1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sasho [114]
3 years ago
8

Which type of plant does this alternation of generations diagram belong to?

Biology
2 answers:
kaheart [24]3 years ago
7 0

C, angiosperms bc angiosperms are flowering plants

andriy [413]3 years ago
7 0

Answer:

The correct answer will be option-C.

Explanation:

Alternation of generation represents the life cycle where the life of a plant is divided into two phases: haploid gametophyte and diploid sporophyte. Alternation of generation has been observed in the whole plant kingdom.  

In the given question, the diagram represents alternation of generation in angiosperms as it shows a reproductive structure called flower which is a unique feature of the angiosperm.

Thus, Option-C is the correct answer.

You might be interested in
what do the similarities between the skeletal structures of these three species most likely indicate about their evolutionary hi
xxTIMURxx [149]

These three species are distantly related and share a common ancestor

3 0
3 years ago
The Moon appears to have different shapes at different times during the month.
nikdorinn [45]

Answer:

B

Explanation:

As the moon rotates around the Earth the angle of light given off from the sun changes.

3 0
3 years ago
What is the most likely explanation for the smaller size of the hypoxic zone in the year 2000?
Irina-Kira [14]
Due to the reduction in large industrial emmissions such as fertilizers into water zones. 
8 0
3 years ago
Primates evolved during what era ​
DerKrebs [107]
The beginning of the Eocene Epoch Era.
6 0
3 years ago
I really need help with these Marine Science Questions.
Tju [1.3M]
The answer is B:abyssopelagic zone <span> </span>
5 0
3 years ago
Other questions:
  • Ocean water has a salinity of approximately 35,000 parts per million or 3.5%. What are the solute and solvent in ocean water? A.
    5·2 answers
  • Cell division allows ALL multicellular organisms to do what? A. develop B. reproduce C. eliminate waste D. produce energy
    6·2 answers
  • (100 POINTS AND BRAINLYEST WOAHHHH DJFIEDOSADFN) Index fossil can also show evidence of unconformity. True False
    11·2 answers
  • Specialized cells that detect and transmit information to the sensory nerves and the brain are called _____.
    5·1 answer
  • Which of the following statements about artificial erosion is true?
    10·2 answers
  • Which of these stopped operating in 2011? A. space shuttle program B. Kepler Space Telescope C. Hubble Space Telescope D. Intern
    9·1 answer
  • Which of the following diseases is not explained by Germ theory
    12·2 answers
  • As water is cooled from 4° C to 0° C, its density
    12·2 answers
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • At what level does the majority of an ecosystem's biomass lie?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!