Answer:
In the explanation
Explanation:
When you understand the names of muscles it will help you remember where the ... This table shows two examples of muscle names and how to translate them based on their ... Anatomists name the skeletal muscles according to a number of criteria, each of ... Some muscle names indicate the number of muscles in a group.
Answer:
Scientific theories can never be proven true beyond all doubt; they can only be supported by a wide body of evidence. Only one of the statements that follow uses the term theory in its correct, scientific sense.
Explanation:
Answer:
the trapping of the sun's warmth in a planet's lower atmosphere, due to the greater transparency of the atmosphere to visible radiation from the sun than to infrared radiation emitted from the planet's surface.
Explanation:
I think it can be incorrect also so refer to Science teacher also. also.
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
Answer:
Inflammation
Explanation:
Inflammation is an immune response produced in the body in response to the damage or trauma caused by physical or chemical factors.
The injured tissue can allow the entry of the microorganism in the body which could cause disease therefore the immune response gets activated to eliminate the pathogen.
The inflammation is marked by the swelling and redness in the injured portion due to the increased flow of blood carrying the White blood cells in that area. The immune cells interact with the pathogen and kill the pathogen.
Thus, Inflammation is the correct answer.
