Answer:
1100
Explanation:
There is 10% of total energy in each increasing trophic level. 10,000 / 10 = 1,000 ,so there are 1,000 units of energy in trophic level 2.
1,000 / 10 = 100, so there are 100 units of energy in trophic level 3.
1,000 + 100 units of combined energy would be 1,100 units of energy.
Hope this helps!
What are the answer choices?
I’m not sure I’m probably rlly wrong but I think the answer is E
hi here is your answer hope it helps or then sry
Explanation:
the importance of oxygen for animals, researchers suspected that a sudden increase in the gas to near-modern levels in the ocean could have spurred the Cambrian explosion.
Explanation:
The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.
1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.
2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.
3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.
In the given question, both promoter sequence are present in the 5'to 3'strand
3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA
The mRNA will be -
5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.
There are two start codon thus two polypeptides will be synthesized.
1. met-thr-asp-ala-val
2. met-thr-asp-val-ala-ser-ser
