1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
MissTica
3 years ago
12

We use less than 1% of the water on Earth for

Chemistry
2 answers:
vaieri [72.5K]3 years ago
8 0

Answer: drinking, bathing.

Explanation:

Cerrena [4.2K]3 years ago
6 0
Brushing teeth,washing face,washing hands
You might be interested in
"11. Barium nitrate reacts with aqueous sodium sulfate to produce solid barium sulfate and aqueous sodium nitrate. Abigail place
Amanda [17]

Answer:

44 mL of Na2SO4

Explanation:

Step 1:

The balanced equation for the reaction. This is given below:

Ba(NO3)2 (aq) + Na2SO4 (aq) —> BaSO4 (s) + 2NaNO3 (aq)

Step 2:

Determination of the number of mole of Ba(NO3)2 in 20.00 mL of 0.500 M barium nitrate (Ba(NO3)2). This is illustrated below:

Molarity of Ba(NO3)2 = 0.5 M

Volume of solution = 20 mL = 20/1000 = 0.02 L

Mole of solute (Ba(NO3)2) =?

Molarity = mole /Volume

0.5 = Mole of Ba(NO3)2 / 0.02

Cross multiply to express in linear form

Mole of Ba(NO3)2 = 0.5 x 0.02

Mole of Ba(NO3)2 = 0.01 mole

Step 3:

Determination of the number of mole of Na2SO4 that reacted.

Ba(NO3)2 (aq) + Na2SO4 (aq) —> BaSO4 (s) + 2NaNO3 (aq)

From the balanced equation above,

1 mole of Ba(NO3)2 reacted with 1 mole of Na2SO4.

Therefore, 0.01 mole of Ba(NO3)2 will also react with 0.01 mole of Na2SO4.

Step 4:

Determination of the volume of Na2SO4 needed for the reaction. This is illustrated below:

Mole of Na2SO4 = 0.01 mole

Molarity of Na2SO4 = 0.225M

Volume =?

Molarity = mole /Volume

0.225 = 0.01 / volume

Cross multiply to express in linear form

0.225 x Volume = 0.01

Divide both side by 0.225

Volume = 0.01/0.225

Volume of Na2SO4 = 0.044 L

Converting 0.044 L to mL, we have

Volume of Na2SO4 = 0.044 x 1000

Volume of Na2SO4 = 44 mL

Therefore, 44 mL of Na2SO4 is needed for the reaction

6 0
3 years ago
Read 2 more answers
What is the difference between pioneer species and climax communities
bonufazy [111]
Pioneer species are the first species to arrive in an area after succession (hope this helped because i dont know about climax communities)
5 0
3 years ago
Think about chemicals you may have in your home and list as many as you can think of:
MAVERICK [17]

Sucrose; C12H22O11

C9H8O4; acetyl salicylic acid

H2O2; hydrogen peroxide,

NaOH; sodium hydroxideExplanation:

6 0
3 years ago
Read 2 more answers
What happens to these physical properties as the strength of intermolecular forces increases?Increase or decrease?a) melting poi
docker41 [41]

Boiling Point, Melting Point, Viscosity, Surface Tension. Decrease: Vapor Pressure.

6 0
3 years ago
Select the keyword or phrase that will best complete each sentence.
pishuonlain [190]

Answer:

1) acetylide

2) enol

3) aldehydes

4) tautomers

5) alkynes

6) Hydroboration

7) Keto

8) methyl ketones

Explanation:

Acetylide anions (R-C≡C^-) is a strong nucleophile. Being a strong nucleophile, we can use it to open up an epoxide ring by SN2 mechanism. The attack of the acetylide ion occurs from the backside of the epoxide ring. It must attack at the less substituted side of the epoxide.

Oxomercuration of alkynes and hydroboration of alkynes are similar reactions in that they both yield carbonyl compounds that often exhibit keto-enol tautomerism.

The equilibrium position may lie towards the Keto form of the compound. Usually, if terminal alkynes are used, the product of the reaction is a methyl ketone.

3 0
3 years ago
Other questions:
  • 3. A tea kettle holds about<br> of water.<br> 2 mL<br> 200 mL<br> 2L<br> 200 L
    8·2 answers
  • If solution A has twice as much solute as solution B is it possible for them to have the same concentration
    5·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • WILL MARK BRAINLIEST please
    8·1 answer
  • To convert from liters/second to cubic gallons/minute, multiply the number of liters/second by 15.850 0 0.0353 00.2642 0 60
    10·1 answer
  • Select all the statements that accurately describe chemical reactions: Question 2 options: The number of atoms decreases when a
    15·1 answer
  • Why did they focus on higher alcohols to add to or substitute gasoline instead of ethanol? Check all answers that apply. Select
    11·1 answer
  • When a hot metal is dropped into a sample of water, the water___ temperature
    5·1 answer
  • If  O2(g) reacts with H2(g) to produce  H2O, what is the volume of H2O obtained from 1 L of O2?
    14·1 answer
  • How to recover ballpoint ink washed off from a paper?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!