1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
svlad2 [7]
3 years ago
9

Cells typically respond to DNA damage in three ways: by ceasing to grow and divide until the

Biology
1 answer:
yanalaym [24]3 years ago
3 0

Answer:cause less-mature cells to divide too rapidly, often leading to the development of cancer

Explanation: when damage is done dna is divided quickly witch makes them develop cancer

You might be interested in
An organic molecule contains carbon atoms. true or false
Roman55 [17]

Answer: i’m pretty sure that it does contain carbon atoms

Explanation: most organic compounds contain a significant amount of carbon

7 0
3 years ago
Read 2 more answers
What does the polysaccharide monomer look like
faltersainse [42]
Starch<span>, </span>is a polysaccharide<span> made up of hundreds of glucose molecules bonded together</span>
5 0
3 years ago
What is meant by the unexpected consequences of environmental manipulation?
belka [17]
Environmental manipulation of a crop can not only have unexpected consequences, but also have a negative impact on the atmosphere as well. The crops produced might be of inferior quality than expected. The amount of crop that grows can also be less. More water might be needed for the crops to grow. 
8 0
3 years ago
Read 2 more answers
Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
trapecia [35]

Answer:

idk

Explanation:

im very sorry about this but i dont know the answer

7 0
3 years ago
Explain in detail how galen, a physician during the middle ages, expanded on hippocrates’ theory of the four humors and explain
Ann [662]
<span>Hippocrates believed that there are four humors in human body which need balance for a healthy being. These were:
Blood, phlegm, yellow bile, and black bile.</span>
Galen expanded the idea of the humors and introduced four temperaments which were these:
choleric (hot / dry), melancholic (cold / dry), sanguine (warm / moist), and phlegmatic (cold / moist).
Another expansion Galen did was that he gave each humor/temperament physical and psychological qualities and said that even the food items have an association with the certain humor, those foods can effect certain humor in certain ways.
8 0
3 years ago
Other questions:
  • When the choking victim becomes unconscious cpr should be started without checking the pulse?
    13·2 answers
  • NEED HELP ASAP - 30 Points -
    8·1 answer
  • Which of these is a process by which water, carbon dioxide, and energy are formed?
    9·2 answers
  • Which is the correct isotopic notation for a potassium ion that has 19 protons, 20
    11·1 answer
  • Where does most of the phosphorus cycle take place?
    12·1 answer
  • 2. How do living things grow? What is the<br> main factor that limits cell growth?
    7·1 answer
  • Why does lymph need to flow more slowly through the lymph nodes?
    5·2 answers
  • How is the variegated leaf trait inherited?
    6·1 answer
  • What are acellular organisms​
    10·2 answers
  • When a 9:3:3:1 ratio of phenotypes is produced by a cross between two individuals, which phenotypes are present in the rarest cl
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!