1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aev [14]
3 years ago
6

Which enzyme is used to break down bacteria, yeast, and other microorganisms?

Biology
1 answer:
svet-max [94.6K]3 years ago
5 0

Answer:

The use of enzymes or microorganisms in food preparations is an age-old process. With the advancement of technology, novel enzymes with wide range of applications and specificity have been developed and new application areas are still being explored. Microorganisms such as bacteria, yeast and fungi and their enzymes are widely used in several food preparations for improving the taste and texture and they offer huge economic benefits to industries. Microbial enzymes are the preferred source to plants or animals due to several advantages such as easy, cost-effective and consistent production. The present review discusses the recent advancement in enzyme technology for food industries. A comprehensive list of enzymes used in food processing, the microbial source of these enzymes and the wide range of their application are discussed.

Explanation:

You might be interested in
Which student correctly identified the geological process that formed Himilayan mountains?
ValentinkaMS [17]

Answer:

Student 2 is correct!

Explanation:

The Himalayas, which stretch over 2400 km between the Namcha Barwa syntaxis in Tibet and the Nanga Parbat syntaxis in Kashmir, are the result of an ongoing orogeny — the result of a collision of the continental crust of two tectonic plates. This immense mountain range was formed by tectonic forces and sculpted by weathering and erosion.

5 0
3 years ago
Read 2 more answers
a promoter is ( A. binding site for DNA polymerase B.binding site for RNA polymerase C.start signal for replication D.stop signa
Nata [24]
C.) The prefix pro means to advance, in this case the promoter is the chemical that starts the replication
4 0
4 years ago
Explain the following statement "digestion begins in the mouth"
blagie [28]
The mouth is where the food is digested first, saliva is released to break down the food, and teeth break up the food
4 0
3 years ago
EXTRA POINTS **
allochka39001 [22]

Answer: i think the force will be a little smaller and the other force pulling left will be 0

Explanation:

6 0
3 years ago
All of the following are true of the Milky Way EXCEPT that it _____. a. is a spiral galaxy b. has more than 800 billion stars c.
ankoles [38]

Answer:

B. Has more than 800 billion stars.

Explanation:

Because there is more than 800 milion stars.

7 0
4 years ago
Other questions:
  • As the earth revolves around the sun, the earths axis is pointed at
    9·1 answer
  • Mammals produce milk to nurse their young. In humans, which hormone controls milk production?
    14·1 answer
  • Molecule A contains the a. starch necessary for ribosome synthesis in the cytoplasm b. organic substance that is broken down int
    13·1 answer
  • Scientists discovered that the Albert's squirrels became two separate populations during the Grand Canyon's formation; they are
    13·1 answer
  • You record the sea temperature to be 28°C, the humidity to be very high, and a very light breeze. Do you expect a hurricane to f
    5·1 answer
  • What would happen to a plant if it was put under a green light?
    10·2 answers
  • Which of the following is problem created when a cell becomes to large
    5·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Janine’s hands are larger than her father’s hands. Which explanation can account for the difference in hand size between father
    5·1 answer
  • What are the four layers that make up the earth?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!