1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Leya [2.2K]
3 years ago
5

Define the five systems

Biology
1 answer:
svlad2 [7]3 years ago
6 0

Answer:

Updated January 28, 2020

By Kevin Beck

Reviewed by: Lana Bandoim, B.S.

The human body that represents your physical life form has a great many tasks to perform in order to keep its owner alive and operational. At each moment, your heart and lungs are working, and a variety of other things are occurring inside you, even as you sleep. Some of these you can feel but not control, such as digestion; others will forever elude your conscious detection.

It is convenient to divide the many components of the body into systems based mainly on function. In some instances, this scheme makes body systems well localized; in others, they are anatomically dispersed throughout the body. Today, most primary sources offer a total of 11 body systems and functions, described in brief detail below.

Body Systems and Functions

As you have probably already concluded, the different human body systems have a vast array of overlapping and complementary functions. The sympathetic and parasympathetic control of heart rate is an example of the nervous system function interacting with the circulatory system. (The parasympathetic effect on heart rate is to slow it; sympathetic input accelerates it.)

Brought to you by Sciencing

The Circulatory System: Also called the cardiovascular system, the heart and blood vessels have the job of delivering oxygen and nutrients to the rest of the body and collecting waste products for removal from the body by other systems.

The Respiratory System: Your lungs allow you to inhale and exhale air to exchange gases between blood and lung space deep within the lungs themselves. The carbon dioxide produced in metabolism is "off-loaded," while oxygen from air is "on-loaded" to red blood cells.

The Skeletal System: Your bones, cartilage and ligaments provide a structural framework for the rest of you, like a scaffolding for organs and tissues. This system affords protection of vital organs and permits locomotion of the organism; the bone marrow in the middle of long bones makes immune cells.

The Muscular System: Muscles comes in three main types. Skeletal muscles move you around and perform other functions when you contract them voluntarily. Smooth muscle lines organs such as the gut and bladder and operates involuntarily. Cardiac muscle is a specialized kind of muscle in the myocardium of the heart.

The Integumentary System: This includes the skin, hair and nails, mostly the former. This physical barrier helps keep out microorganisms, regulates the moisture level of the organism and keeps temperature steady. The skin and other parts of the integumentary system work hand-in-hand with the body's immune system, such as keeping out germs and bacteria. Sometimes the immune system is listed separately from the integumentary system, leading to 12 body systems and functions rather than 11.

The Digestive System: This system converts ingested foods into smaller molecules your cells can harvest energy from.

The Nervous System: Your brain, spinal cord and a great many peripheral nerves make up this system, which is responsible for collecting, processing and transmitting information.

The Endocrine System: When you hear the word "hormones," think "endocrine system." This system regulates the internal environment of the organism via the dispersal of chemicals (hormones) that act at certain receptors throughout the body. The pancreas, pituitary gland and thyroid gland are part of this system,

The Excretory/Urinary System: Your kidneys help eliminate waste by filtering the blood, keep the acid-base levels of the blood steady, and regulate the amount of blood in the body via electrolyte and other solute balance.

The Lymphatic System: The structures in this system of channels are akin to a second circulatory system, which also includes the spleen, make cells that combat foreign invaders and help return tissue fluid to the blood vessels.

The Reproductive System: This system is responsible for creating gametes, or sex cells (testes in males, ovaries in females) that participate in fertilization and propagation of genes into the next generation of organisms. It includes the uterus in females and external genitalia regardless of sex.

Explanation:

You might be interested in
Why is it necessary to eliminate absolutely all invasive fire ant colonies to eradicate the invasive population?
Rainbow [258]

Answer:

d.  Fire ants spread by winged members and by hitching rides so a single colony can cause infestation.

Explanation:

An invasive fire ant colony can be very disastrous to the population of organisms in a locality. They cause massive competition with the native species thereby infesting them and destroying the native population.

Fire ants spread by winged members which makes a single colony to cause severe damage to the native specie. Often times, as they become endemic, they manifest as the dominant specie in a particular location.

4 0
3 years ago
Read 2 more answers
Explain why most farmers use stem cuttings to plant new fruit trees rather than plant seeds.
Dvinal [7]

The main reason that most farmers use stem cuttings rather than just planting a seed is that a tree's genetic variation will occur. The seeds of many fruit trees tend to vary differently from the parent, because seeds themselves are produced by sexual reproduction (i.e they receive genes from a male and female to form). As they are a cross from two sets of genes, many fruit trees are not “true to seed”. Their seeds will produce a generally different variety of tree from the parent. When using stem cuttings, it's almost like a cloning process.

4 0
3 years ago
Read 2 more answers
cells use atp constantly, but atp is considered a renewable resource. what process makes this possible?
Helga [31]

Answer:

the process of metabolism works to make it possible, when its seems liie being impossible.. so?

3 0
3 years ago
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymer
quester [9]

Answer:

1) The right end is the 5' region and the left end is the 3' region

2) 5'-UAACGGUGCAUCGAUAGCAUGC-3

       

5 0
3 years ago
What organ and system protects by forming a selective barrier?
Radda [10]

Skin and Integumentary system protects by forming a selective barrier.  

<u>Explanation</u>:

Multicellular organisms unlike unicellular organism have a variety of systems each having a different function. The body of multicellular organisms is covered with epidermis or skin which is known as  largest organ of the body. The skin consists of many sensory receptors and protects by enclosing muscles and other body tissues. While Integumentary system is made with skin and its various appendages like hair, feathers, nails etc. with receptors and secretary pores and protects the body from pain.

6 0
4 years ago
Other questions:
  • What is a ligand? what do ligands have to do with receptor-mediated endocytosis?
    14·1 answer
  • A special protein in your blood captures and carries oxygen. This protein is called what
    13·1 answer
  • Compared to earth's crust, earth's core is believed to be
    14·1 answer
  • Chris, who works at a pesticide factory, comes to the clinic complaining of muscle spasms that interfere with his movement and b
    14·1 answer
  • Mark's misuse of alcohol and other addictive drugs is influenced by genetic factors, by the ready availability of drugs in Mark'
    13·1 answer
  • What else can you infer from age structure diagrams
    8·1 answer
  • Oogenesis occurs in the -----<br><br> Spermatogenesis occurs in the ------?
    9·2 answers
  • Three factors that affect the abiotic environment of a tropical rainforest
    9·1 answer
  • What to expect in life science test for term one
    6·1 answer
  • Which one of the following is a treatment plant operator NOT responsible for:
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!