1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Margarita [4]
3 years ago
8

Which drawing is structural model of C3H8?

Chemistry
1 answer:
wlad13 [49]3 years ago
7 0

Answer:

option B is the correct answer

You might be interested in
J. Explain how an atom's valence electron configuration determines its place on the periodic table.​
Darya [45]

Answer:

Elements having same valence electrons are placed in <u>same group.</u>

Explanation:

First, let's start with some basic concepts of modern periodic table:

1. Modern Periodic table : It is the arrangement of element in the increasing order of their atomic numbers

The Modern periodic table is divided into Periods and groups .

Periods : These are the horizontal rows. There are seven periods in the periodic table . Period 1 has 2 element. Period two and three has 8 elements , period 4 and 5 have 18 elements and the period 6 and 7 have 32 elements.

Same period have same number of atomic orbital(Shell)

Group : The group is the vertical columns . There are 18 groups in the modern periodic table.Those element which have same group number will also have same number of electron in their outermost shell. The number of electron in the outermost shell determines the valency of the element.

So, elements showing same valency are placed in same group.

All alkali are place in group 1 and have 1 valance electron in the outermost shell

5 0
4 years ago
What do you call the things in an experiment that must be the same to make it fair​
Pavel [41]

Answer:

controlled variables

Explanation:

3 0
3 years ago
Read 2 more answers
With white light, a team measured a 0.7% percent change with 3.5g of plant matter in a one liter container. Convert
Strike441 [17]

moles CO₂ = 5.57.10⁻⁴

<h3>Further explanation   </h3>

A mole is a number of particles(atoms, molecules, ions)  in a substance

Can be formulated :

\tt mol=\dfrac{mass}{MW}

0.7% percent change with 3.5g of plant matter

mass :

\tt 0.7\%\times 3.5~g=0.0245~g

moles :

\tt moles=\dfrac{0.0245}{44}=0.000557=5.57.10^{-4}

5 0
3 years ago
When water decomposes into oxygen and hydrogen, the mass
Maurinko [17]
<span>When water decomposes into oxygen and hydrogen, the mass "Remains Constant" as according to Law of Conservation of mass, mass can neither be created not destroyed,.

In short, Your Answer would be Option A

Hope this helps!</span>
8 0
3 years ago
Which is a possible result of rising ocean temperatures caused by global warming?
goldfiish [28.3K]
Pretty sure it’s 2, increase in strength of hurricanes
3 0
3 years ago
Other questions:
  • What is the formula and name of the compound formed between na+ and o2-
    8·1 answer
  • the curved movement of air or water is the result of which of these. A).Winds speeding off equater B).the rotation of earth on i
    8·2 answers
  • Explain why the several different types of microscopes are all necessary.
    9·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • What's the reason for the Antarctic sea ice?
    6·1 answer
  • Are substances that taste bitter and feel slippery to the skin
    9·1 answer
  • What is a substance​
    6·1 answer
  • Can we talk about planets or talk about life lol (keep kid friendly)
    6·2 answers
  • Describe a method you could use to carry out paper chromatography.
    7·1 answer
  • For a covalent bond to be polar, the two atoms that form the bond must have:.
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!