All categories

3 years ago

Which evidence is provided by fossil record

Biology

1 answer:

GalinKa [24]3 years ago

3 0

The fossil record

This supports Darwin's theory of evolution, which states that simple life forms gradually evolved into more complex ones. Evidence for early forms of life comes from fossils. By studying fossils, scientists can learn how much (or how little) organisms have changed as life developed on Earth.There are gaps in the fossil record because many early forms of life were soft-bodied, which means that they have left few traces behind. What traces there were may have been destroyed by geological activity. This is why scientists cannot be certain about how life began.

Fossils provide a snap shot of the past and allow us to study how much or how little organisms have changed as life developed on Earth.

You might be interested in

Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi

jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0

3 years ago

3. What sedimentary rock is made up of pieces

Alexxx [7]

Answer:

6. Because of how old the rocks are

Explanation:

6. Sedimentary rock forms in layers because of the order they were formed. The older rocks will form first and as time goes on, rock forms above it to create a new layer, and so on.

3 0

3 years ago

The information carries by DNA incorporated in a code specified by the ?

Lady_Fox [76]

Answer:

The information carried by DNA is incorporated in a code specified by the: specific nucleotide sequence of the DNA molecule. The enzyme DNA ligase is responsible for: linking short DNA segments.

Explanation:

3 0

3 years ago

Which event takes place during normal fertilization?

Minchanka [31]

The event which takes place during normal fertilization is zygote formation.

<h3>Which event takes place during fertilization?</h3>

The major event which is characteristic of fertilization is zygote, otherwise termed cell formation in which case, the zygote is capable of undergoing cell division to form a new living cell. The fusion of two gametes necessary for fertilization kick-starts several reactions in the egg.