1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
geniusboy [140]
3 years ago
6

Which evidence is provided by fossil record

Biology
1 answer:
GalinKa [24]3 years ago
3 0

The fossil record

This supports Darwin's theory of evolution, which states that simple life forms gradually evolved into more complex ones. Evidence for early forms of life comes from fossils. By studying fossils, scientists can learn how much (or how little) organisms have changed as life developed on Earth.There are gaps in the fossil record because many early forms of life were soft-bodied, which means that they have left few traces behind. What traces there were may have been destroyed by geological activity. This is why scientists cannot be certain about how life began.

Fossils provide a snap shot of the past and allow us to study how much or how little organisms have changed as life developed on Earth.

You might be interested in
Intensely biosynthetic secretory protein cells such as neurons would be expected to have greater amounts of _________ than other
Rus_ich [418]

AnsweR:

Rough endoplasmic reticulum.

Explanation:

The endoplasmic reticulum is a member of the endomembrane system and is present as a continuation of the nuclear membrane. They are divided into the rough endoplasmic reticulum and smooth endoplasmic reticulum.

Rough endoplasmic reticulum has ribosomes on its surface and is responsible for the synthesis of secretory proteins. Smooth endoplasmic reticulum synthesize lipids.

Therefore cells that intensely biosynthesize secretory proteins like neurons, white blood cells have a greater amount of rough endoplasmic reticulum than another cell of the body.

8 0
3 years ago
Scientists first found dinosaur fossils about 1820. The fossils suggested that dinosaurs were large, slow, reptiles. This view w
kherson [118]

Answer:

C

Explanation:

5 0
3 years ago
Read 2 more answers
Ventifacts are created by a process of erosion called 
BaLLatris [955]

The answer is B. deflation

5 0
4 years ago
Read 2 more answers
Why is Pluto no longer considered a planet? It is not large enough to be a planet. Pluto does not orbit the sun as originally th
Liono4ka [1.6K]

Pluto is not considered a planet due to all the reasons you stated above

5 0
3 years ago
Read 2 more answers
Explain the process of DNA Replication in details
ser-zykov [4K]

Answer:

DNA replication is the process by which a double-stranded DNA molecule is copied to produce two identical DNA molecules. ... Once the DNA in a cell is replicated, the cell can divide into two cells, each of which has an identical copy of the original DNA.

In the eukaryotic cell cycle, chromosome duplication occurs during "S phase" (the phase of DNA synthesis) and chromosome segregation occurs during "M phase" (the mitosis phase).

Explanation:

4 0
3 years ago
Other questions:
  • Select the best answer for the question.
    8·1 answer
  • Needing help on number 16
    5·1 answer
  • Best way to describe Neptune
    8·1 answer
  • Which of the following is NOT a nitrogenous base found in DNA?
    8·2 answers
  • Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence (59)GCGCAATATTTCTCAAAATATTGCGC(39
    6·1 answer
  • Amino acids with hydrophobic R groups are most often found in the interior of folded proteins. true false
    11·1 answer
  • ASMP Help please with this
    12·2 answers
  • Will give brainliest
    12·1 answer
  • Rr is a heterozygous dominant trait<br><br> Group of answer choices<br><br> True<br><br> False
    15·2 answers
  • 1 point
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!