Answer:
If its dna replication the answer will be TCCCCTAGTCGTGGCCTAAAGTACTCGG
If its transcription the answer will be UCCCCUAGUCGUGGCCUAAAGUACUCGG
Explanation:
Answer:
Below
Explanation:
1. Sedimentary rock
2. Metamorphic rock
3. Magma
4. Igneous rock
5. Weathering and Erosion Ign.
6. Weathering and Erosion Met.
7.Weathering and Erosion Sed
8. Compaction and Sedimentation.
9. Heat and pressure Sed.
10. Heat and pressure Ig
11. Melting
It’s True..................
......
.........
Answer:
genes
Explanation: I know this because genes make up chromosomes and those make up our dna.
hope this helps!!!
The body's chemical buffer system consists of three individual buffers: the carbonate/carbonic acid buffer, the phosphate buffer and the buffering of plasma proteins. While the third buffer is the most plentiful, the first is usually considered the most important since it is coupled to the respiratory system.
Carbonic acid (H2CO3) is a weak acid and is therefore in equilibrium with bicarbonate (HCO3-) in solution. When significant amounts of both carbonic acid and bicarbonate are present, a buffer is formed. This buffer system can be written as:
H2CO3 + H2O  H3O+ + HCO3-
Under normal circumstances there is much more bicarbonate present than carbonic acid (the ratio is approximately 20:1). As normal metabolism produces more acids than bases, this is consistent with the body's needs. The blood, with its high base concentration, is able to neutralize the metabolic acids produced. Since relatively small amounts of metabolic bases are produced, the carbonic acid concentration in the blood can be lower.
Since carbonic acid is not stable in aqueous solutions some of it decomposes to form carbon dioxide and water. The respiratory system is responsible for removing the carbon dioxide.
H2CO3  H2O + CO2
By combining the two reactions of carbonic acid we can write:
