1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
choli [55]
3 years ago
14

Organisms that live in the tundra have developed unique adaptations that aid in their survival. Ursus maritimus has a variety of

adaptations which enable it to survive in the tundra. It is the largest terrestrial carnivore, but it is also an excellent swimmer that spends much of its time in and near the water hunting its favorite food. It has large paws with small bumps to provide traction as it walks across the ice. Its fur is helpful as camouflage during the winter months, but not as helpful during the summer. Which organism has the adaptations described that enable it to survive in the tundra?
A. harp seal
B. arctic fox
C. polar bear
D. Kodiak bear
Biology
2 answers:
taurus [48]3 years ago
5 0
The organism that has all the adaptations listed above is C. polar bear.
Nataliya [291]3 years ago
4 0
<h2>C. Polar bear.just took the test</h2>
You might be interested in
Which of statements is/are true for sexual reproduction in plants?
Yuliya22 [10]
4 fertilization can occur only after pollination
6 0
3 years ago
In regulation by repression Multiple Choice an amino acid activates the repressor so that the repressor binds to the operator an
Artyom0805 [142]

Answer:

An amino acid activates the repressor so that the repressor binds to the operator and prevents transcription.

Explanation:

In an operon, promoter is followed by operator which is finally followed by the structural genes to be transcribed. RNA Polymerase binds to the promoter and initiates transcription. A repressor can negatively control the transcription process by binding to the operator so that the RNA Polymerase is not able to move forward and transcription is halted.

For example: in trp operon, tryptophan amino acid binds to the repressor molecule which leads to change in repressor's shape. The repressor is now able to bind to the operator and prevent transcription.

7 0
2 years ago
Which of the following is an example of an insect that laps up food?
german
The Colorado potato beetle 
5 0
3 years ago
Helpppp urgent
Amiraneli [1.4K]

Answer:D

Explanation:

7 0
2 years ago
Question 1 (1 point)
Dennis_Churaev [7]
C is the answer just did it
5 0
2 years ago
Other questions:
  • Which of the following sequences represents the hierarchy
    8·1 answer
  • Name the ridged bundles of muscle found projecting inside the right atrium. View available hint(s) name the ridged bundles of mu
    5·1 answer
  • After reading the text in Blackboard, please answer the question: “Which theory do you believe best explains how life on Earth b
    10·2 answers
  • What is the catalase test? Coagulase test? What does it mean to be: Catalase + Catalase - Coagulase + Coagulase - When working w
    8·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Which of the following could lead result in secondary succession
    14·1 answer
  • HELP I WILL GIVE THE CROWN
    13·1 answer
  • Will mark brainliest
    14·1 answer
  • HURRY PLZ VERY TIME SENSITIVE DUE TOMMOROW!!
    5·1 answer
  • The network of nerves that regulate digestive motility, secretion, and blood flow is called the __________ system.
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!