1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Talja [164]
2 years ago
6

What did Darwin discover about plants from his phototropism experiments?

Biology
1 answer:
mel-nik [20]2 years ago
7 0

Answer:

https://www.biology-pages.info/T/Tropisms.html

Explanation:

This link holds all the information you need :D

You might be interested in
Unlike rocks, all minerals ________ and ________.
Maurinko [17]

The correct answer is B!

Why is this?

A mineral is a naturally occurring, inorganic solid with a definite crystalline structure and chemical composition. All minerals contain one or more elements, which are pure substances that cannot be broken down into simpler substances by chemical means.

8 0
3 years ago
The information in dna is contained in __________.
ELEN [110]

Answer:

the cell nucleus

8 0
2 years ago
Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
Alla [95]

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong

8 0
2 years ago
Which of the following would most likely result in the greatest decrease in the rate of a chemical reaction ?
g100num [7]
<span>Most likely result in the greatest decrease in the rate of a chemical reaction would come from the correct posting of all your answer choices available</span>
5 0
3 years ago
What is the best characterization of a fine grained igneous rock?.
Ede4ka [16]
It’s cranky and white shaped where it’s pretty shiny and crystals inside them where they spark off your eyes
8 0
2 years ago
Other questions:
  • A pea plant with round seeds has the genotype rr. if you cross this plant with a wrinkled-seed plant, genotype rr, what is the p
    11·1 answer
  • Dividing a cell into more than one cell is called __________.
    13·1 answer
  • The length of giraffes' necks enables them to reach leaves that most other herbivores can reach. If a giraffe is born with a ver
    13·1 answer
  • How does ATP provide energy to your body? Please make it short
    7·1 answer
  • Question 4
    8·2 answers
  • Based on what you know about life on Earth what might scientists be most likely to look for on other planets with regard to livi
    9·1 answer
  • While cleaning a saltwater aquarium, students placed a family of fiddler crabs from the saltwater aquarium into a container of d
    5·2 answers
  • If I hold my breath for 30 seconds, then my heart rate will increase or decrease?
    12·2 answers
  • You are an ecologist studying the life history of a newly discovered animal. You find that it reproduces slowly and has only one
    9·1 answer
  • The inner membranes of both mitochondria and chloroplasts are folded into various arrangements. What is the advantage of having
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!