1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
timofeeve [1]
3 years ago
15

What does population mean in a community?

Biology
1 answer:
Natali [406]3 years ago
5 0
A population in a community means the specific kind of organism(plants and animals) living in a community (all the living things in an ecosystem)
You might be interested in
What are some possible scenarios that could lead to the extincion of a group of organisms?
Alex Ar [27]
Some possible scenarios include worldwide temperature change, worldwide disease breakout, environmental change, and lack of resources.
5 0
3 years ago
several species of warblers (bird) live in different areas of the same tree . this phenomenon is known as
Gekata [30.6K]

Answer:

This phenomenon is called Niche Differentiation, it happens when several species live in the same area but different parts. Hope that helps! :)

6 0
3 years ago
How do chemoautotrophs make energy?
denis-greek [22]

Explanation:

Carbon dioxide water and energy are the typical products of the breakdown of which type of molecule

7 0
3 years ago
Identify a scenario where an experiment would be replicated
Vsevolod [243]

Answer:

If you did not follow the procedure as you should have.

Explanation:

You may have to repeat an experiment for several reasons. It can be because you need to be certain of the results so that you have to perform it several times. Or you need more precise results so that you can fine-tune the variables and repeat the experiment again.

The most common scenario where an experiment would be replicated would be in a situation where you did not follow the procedure that you have outlined exactly like you should have so that the results you got are not 100% reliable. In such a case, the experiment would need to be replicated for the correct results.

I hope this answer helps.

3 0
3 years ago
1 2 3 4 5 6 7 8 9 10
frez [133]
Observation experiment
5 0
3 years ago
Other questions:
  • The system that removes waste in the blood from the body
    8·1 answer
  • Order from longest to shortest
    5·1 answer
  • Sound waves entering the ear canal lead to vibrations in the _________, which then creates a fluid wave first in the ___________
    12·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • The "Father of Modern Taxonomy" is _____. Aristotle Linnaeus Theophrastos Cordus
    6·2 answers
  • A body cell is in the longest stage of its life cycle. The cell grows, synthesizing proteins and increasing in size. Eventually,
    10·1 answer
  • If homeostasis is not maintained, what disease/disorder may occur in the respiratory system
    5·1 answer
  • What happens to the enzyme activity of A after 30 degrees
    8·1 answer
  • Based on the information given above, which of the following models best represents the relationship between zooplankton , minno
    13·1 answer
  • List a few of the ways that Thuret tells us we can control neurogenesis. Specify whether the activity increases or decreases neu
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!