1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Olenka [21]
2 years ago
10

How does land use change as the human population increases?

Biology
2 answers:
garik1379 [7]2 years ago
7 0

Answer:

Forestland becomes developed land.

Explanation:

tia_tia [17]2 years ago
3 0
The answer is below!


You might be interested in
Which two factors are mostly responsible for recent rapid globalization?
natali 33 [55]
I am going to assume you are working on a test or a quiz. Please provide your answer choices becuase I might have taken the same test or quiz as you recently. (:
8 0
3 years ago
Read 2 more answers
The skin is superficial to the bone
telo118 [61]
Superficial is a used to describe structures that are closer to the exterior surface of the body. Deep refers to structures closer to the center of the body region. For example, skin is superficial to bones, and bones are deep to skin.
3 0
3 years ago
14. Scientist wanted to know if temperature effected the movement of
Advocard [28]

Answer:

movement

Explanation:

the movement depends on the temp.

7 0
2 years ago
Read 2 more answers
The deep palmar veins drain into the radial and ulnar veins; then those veins, along with the anterior crural interosseous vein,
galina1969 [7]

Answer:

Brachial vein.

Explanation:

Veins may be defined as the blood vessels that carries the blood towards the heart. The main function of the vein is to carry the deoxygenated blood into the heart.

Brachial vein is the deep veins that has the name as their arteries occupy. The brachial veins receive their blood from the palmar veins with the interosseous vein. The brachial veins include the ulnar vein, radial vein in upper limb and lower limb consists of popliteal veins.

Thus, the answer is brachial veins.

3 0
3 years ago
4. Which of the three major types of membrane receptors is often used by bacteria to cause infections?
vodka [1.7K]

Answer:

on channel-linked receptors, G-protein-linked receptors, and enzyme-linked receptors.

The ability of cells to communicate through chemical signals originated in single cells and was essential for the evolution of multicellular organisms. In multicellular organisms, cells send and receive chemical messages constantly to coordinate the actions of distant organs, tissues, and cells. Cells can receive a message, transfer the information across the plasma membrane, and then produce changes within the cell in response to the message. Single-celled organisms, like yeast and bacteria, communicate with each other to aid in mating and coordination. Cellular communication has developed as a means to communicate with the environment, produce biological changes, and, if necessary, ensure survival.

4 0
3 years ago
Other questions:
  • What are two generalizations you could make about the spread of enlightenment ideas?
    8·1 answer
  • Which should a scientist conclude about data that are inconsistent with the current, scientific understanding of amphibian repro
    6·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • You have chosen to study the genetics of snapdragon flower color. True-breeding red-flowered plants crossed with true-breeding w
    12·1 answer
  • The __________carries oxygen-poor venous blood from above the diaphragm from areas of the upper body and extremities into the ri
    7·1 answer
  • Based on the textbook's description of the inheritance of hair texture, can two parents heterozygous for wavy hair still produce
    15·1 answer
  • Which of the following processes occurs when nuclei begin to surround the chromosomes on either end of the pole during meiosis I
    8·1 answer
  • What will happen to the rate of
    15·2 answers
  • Me ayudan con esto es para la 8:00 pm de colombia :v
    13·1 answer
  • Scientists believe that there are three jeans what contribute to skin color in humans.
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!