1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nadezda [96]
3 years ago
12

The volume of space in an atom where an electron is likely to be found is called the ______ of that electron. Multiple choice qu

estion.
Biology
1 answer:
dedylja [7]3 years ago
3 0

Answer:

The volume of space in an atom where an electron is likely to be found is called the orbital of that electron.

You might be interested in
HELP PLS!!!!!!!!!!!!!
ivann1987 [24]

Answer: 1. is organism

Explanation: it just is

8 0
3 years ago
How does global warming effect climate change?​
anzhelika [568]

Answer:

world go warm climate go hot

5 0
3 years ago
Characteristics of life living things worksheet biology 
SCORPION-xisa [38]

Answer:

There is no pic Explanation:

7 0
3 years ago
Which of the following describes the relationship between population and species?
djverab [1.8K]

Answer:

A population consists of all individuals of all species in one area

3 0
3 years ago
Read 2 more answers
"which of these contributes to the existence of monopoly power?"
lora16 [44]
I think the correct answer is A

7 0
3 years ago
Other questions:
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • What method can scientists use to determine the absolute age of a rock?
    12·2 answers
  • How does convection cause the landforms
    8·2 answers
  • Does protein have more calories than fat
    14·1 answer
  • Which of the following came about because of shifts and changes in word meanings?
    5·1 answer
  • Which can have the most impact on an ecosystem
    7·2 answers
  • What would cause a decrease in the quality of circulating red blood cells
    11·1 answer
  • Someone pls help! I will choose brainleist!
    10·2 answers
  • From the graph, how can water's high specific heat capacity be observed? A) The ocean surface temperature and the land surface t
    6·1 answer
  • What are the functions of the stratum corneum layer of the skin? select all that apply.
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!