1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
seropon [69]
2 years ago
14

What is the value of X

Mathematics
2 answers:
skelet666 [1.2K]2 years ago
8 0
X is 3 your are welcome
Vesnalui [34]2 years ago
5 0

Answer:

x = 9

Step-by-step explanation:

9/72 = (3x-20)/56

9(56) = 216x - 1440

504 = 216x - 1440

216x = 1944

x = 9

You might be interested in
Answer please i need help
Hunter-Best [27]
32^2 feet so ya know
6 0
3 years ago
Read 2 more answers
What is the value of x in the equation x – y = 30, when y = 15
Mekhanik [1.2K]
The answer is 45 because 45-15=30, therefore x=45.
6 0
3 years ago
Read 2 more answers
the diagonal of a rectangular picture frame is 12 inches and it's length is 9 inches what is the width of the picture frame ?
sladkih [1.3K]
I think it would be 5

4 0
3 years ago
Sneezie's Tissues currently packages
QveST [7]

Answer:

  • 3 times

Step-by-step explanation:

<u>Volume of the pyramid:</u>

  • V = lwh/3

<u>Volume of the prism:</u>

  • V = lwh

<u>Since all dimensions remain as is, the volume of the prism is:</u>

  • lwh / (lwh/3) = 3 times greater
6 0
2 years ago
Ho do you get the Surface Area of this shape?
blsea [12.9K]
This solid object contains 8 sides.

The side that is facing you has a surface area:

64f{ t }^{ 2 }+84f{ t }^{ 2 }=148f{ t }^{ 2 }

The side exactly opposite this one has the same surface area - 2 sides with this surface area in total.

The bottom side has a surface area:

84f{ t }^{ 2 }

The side to your right has a surface area:

84f{ t }^{ 2 }

The side to your left has a surface area:

48f{ t }^{ 2 }

The side to your top left has a surface area:

48f{ t }^{ 2 }

The side beside the side to the top left has a surface area:

36f{ t }^{ 2 }

The side at the very top has a surface area:

36f{ t }^{ 2 }

Combined, the surface area is:

S=2\cdot 148f{ t }^{ 2 }+2\cdot 84f{ t }^{ 2 }+2\cdot 48f{ t }^{ 2 }+2\cdot 36f{ t }^{ 2 }

\\ \\ =296f{ t }^{ 2 }+168f{ t }^{ 2 }+96f{ t }^{ 2 }+72f{ t }^{ 2 }\\ \\ =632f{ t }^{ 2 }

Therefore the answer is: C
7 0
2 years ago
Other questions:
  • Solve the inequality -2x+20&lt;2x+4
    12·1 answer
  • Helppppppppppppppppppppppppppppppppppp
    9·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • Please help me on this geometry problem
    10·1 answer
  • Which pair of ratios is proportional?
    13·2 answers
  • Determine the equation of the circle graphed below.
    14·1 answer
  • 380% of what is 99? (Round to the nearest whole number)
    5·2 answers
  • I need help please please.
    6·2 answers
  • Plzzz help meeeee <br><br><br> Finding Anglessss
    12·1 answer
  • The cost of 32 containers of her than this at a grocery store is $96 what is the price per container of hummus?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!