1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aliina [53]
3 years ago
7

The part of the muscular system responsible for movement is

Biology
1 answer:
alexira [117]3 years ago
6 0
C.

the skeletal muscles are attached to the bones which are partly controlled by the central nervous system.
You might be interested in
Where is the cell membrane located in a cell with no cell wall
Oduvanchick [21]
I'm pretty sure that the cell membrane acts as the cell wall if you understand what I'm saying. The cell membrane will be the outermost structure.
8 0
3 years ago
Read 2 more answers
Modern europeans may have acquired genes that helped them adapt to the cold and absorb more vitamin d through interbreeding with
notsponge [240]
Around 100,000 years ago there was a second hominine species closely related to modern humans,  Homo <span><span>neanderthalensis,</span><span> or commonly called the Neanderthal</span>.</span> Recent studies of neanderthal DNA have shown that there is 3-4% of their genes in modern humans outside of Africa, mostly from Europe, including the ones for adapting to the cold and vitamin D absorption. 
3 0
3 years ago
What type of plate boundary could form a mountain chain of sedimentary rock? PLEASE ANSWER NOW 
Dima020 [189]
The answer is C i loooked it up 
6 0
3 years ago
Huntington's disease is caused by an autosomal dominant allele. It is a lethal
Ilia_Sergeevich [38]

The answer would be D. Huntington's disease presents symptoms in humans after many have already reproduced; therefore, they are unaware that they passed on Huntington's disease.

3 0
3 years ago
A substance that yields a cation plus the hydroxyl ion in water is a(n)_____.
ivanzaharov [21]
The substance that yields a Cation plus the Hydroxyl ion in water is a Base. 
A Cation is a positively charged ion. A Hydroxyl ion is an ion with a negative charge and is made up on one oxygen atom and one hydrogen atom. Bases are substances that promote chemical reactions. Dissociation is a process in which ionic compounds split into smaller particles. 
<span>In this case, the base acts by dissociation to yield a Cation plus a Hydroxyl ion in water. </span>
4 0
3 years ago
Other questions:
  • What does photosynthetic biomass mean
    5·1 answer
  • The ______ system works with the circulatory system to maintain the correct water balance in cells.
    11·2 answers
  • PLS HELP 20 POINTS ASAP!!! WILL GIVE BRAINLIEST TO CORRECT ANSWER
    5·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Whar it is impoertance to live a healthy lifestyle on the early years?​
    15·1 answer
  • Approximately what percent of the Earth’s surface is covered by ocean?
    10·2 answers
  • A large number species on Earth become extinct during a short time period about 65 million years ago. Based on this pattern of e
    9·1 answer
  • Ahhh I need help helpppppppp
    5·2 answers
  • A healthy individual is a carrier of a lethal allele but is unaffected by it. What is the genotype of this individual?
    8·1 answer
  • What type of questions does developmental biology address?​
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!